The existing studies show that the PCV3 genome is 2,000 bp in length, which is similar to the PCV1 and PCV2 genomes, and includes three open reading frames ORF1, ORF2, and ORF3 (19). ORF1 encodes a replication-associated protein, ORF2 encodes a capsid protein, and ORF3 encodes a protein unique to it. In recent years, studies of the molecular characteristics and pathogenicity of PCV3 have received increasing attention due to the widespread infection in pigs all over
the world (5, 13). It has been reported that PCV3 can infect a host alone or co-infect with other pathogens (32). Infection is documented as being associated with swine reproductive failure, fever, respiratory diseases, and multi-system inflammation. However, the pathogenesis of PCV3 and its role in co-infections remains unclear (5, 19, 31, 32). In addition, it has been noted that PCV3 infection can cause diseases such as congenital tremor and myocarditis in newborn piglets (4, 9, 17).
Xinjiang province, located in the northwest of China, covers an area of 1,665,900 km2 and is the most important animal husbandry region in China. In recent years, with the rapid development of the pig industry in Xinjiang, the number of live pigs has reached 4.1 million, and raising pigs has become an important means for farmers to increase their incomes. However, with the continuous intensification and expansion, reproductive disorders and infectious diseases of the respiratory and digestive tracts of pigs have also surged in prevalence, which has caused huge economic losses to the pig industry. As a newly discovered cross-border transmissible virus, the current infection status and molecular characteristics of PCV3 in Xinjiang are still unclear.
The purpose of the present study was to investigate the infection status and explore the molecular characteristics of Xinjiang strains of PCV3 in commercial pigs, which will provide useful molecular data for understanding the epidemic pattern of this infectious disease.
GenBank accession numbers of PCV3 strains
Strain | Accession number |
---|---|
2164 | KX458235 |
PCV3-US/MN2016 | KX898030 |
PCV3-US/SD2016 | KX966193 |
PCV3/CN/Fujian-5/2016 | KY075986 |
PCV3/CN/Henan-13/2016 | KY075988 |
PCV3/CN/Jiangxi-62/2016 | KY075989 |
PCV3/CN/Chongqing-150/2016 | KY075992 |
CN/Hubei-618/2016 | KY354039 |
CCV-A | KY363870 |
CCV-B | KY363871 |
CCV-C | KY363872 |
PCV3-China/GD2016 | KY418606 |
PCV3/KU-1601 | KY996337 |
PCV3/KU-1604 | KY996340 |
PCV3/KU-1606 | KY996342 |
PCV3/KU-1608 | KY996344 |
PCV3/KU-1609 | KY996345 |
P1705SCYC/2017 | MF063070 |
16R927/2016 | MF063071 |
PCV3-BR/RS/6 | MF079253 |
PCV3/CN/Jiangxi-B1/2017 | MF589107 |
PCV3/CN/Jiangxi-S1/2017 | MF589133 |
PCV3/CN/Guangdong-CH/2016 | MF589112 |
PCV3/CN/Guangdong-X1/2016 | MF589118 |
309 | MF589652 |
JX-1/CH/2017 | MF677838 |
1621_Italy_2017 | MF805719 |
4332-5_Denmark_2017 | MF805723 |
4332-7_Denmark_2017 | MF805724 |
DE2.8 | MG014377 |
DE19.15 | MG014367 |
DE27.16 | MG014370 |
PCV3/HU/Szerencs/2017 | MG595741 |
PCV3-RU/TY17 | MG679916 |
PCV3-JSXY-201701 | MG868940 |
PCV3-HBWH-201703 | MG868941 |
PCV3-SH-201705 | MG868945 |
SD | MG947596 |
PCV3-CN2018HLG-5 | MH277111 |
PCV3-CN2018JL-1 | MH277112 |
PCV3-CN2018LN-3 | MH277117 |
COL/Cundinamarca2/2018 | MH327785 |
CN/Xinjiang-AK16/2018 | MK562412 |
CN/Xinjiang-AL5/2018 | MK562413 |
CN/Xinjiang-CH29/2018 | MK562414 |
CN/Xinjiang-KA2/2018 | MK562415 |
CN/Xinjiang-KO17/2018 | MK562416 |
CN/Xinjiang-SH6/2018 | MK562417 |
CN/Xinjiang-TA36/2018 | MK562418 |
CN/Xinjiang-UR22/2018 | MK562419 |
CN/Xinjiang-YI7/2018 | MK562420 |
29160 | NC031753 |
List of primer sequences used in this study
Primer name | Nucleotide sequence | Position in reference | Product size |
---|---|---|---|
(5′→ 3′) | sequence | (bp) | |
FP1 | CCGTAGAAGTCTGTCATTCCAG | 1383–1404 | |
RP1 | AAGCCCTGGCACGCCAACCAC | 1796–1816 | 434 |
FP2 | TTAGAGAACGGACTTGTAACGA | 1343–1364 | |
RP2 | ATGAGACACAGAGCTATATTCAG | 1965–1987 | 645 |
Detection of PCV3 infection in different samples from commercial pig farms in Xinjiang province, China
Clinical samples | Number of samples | Number of positive samples | Positive rate (%) of PCV3 |
---|---|---|---|
Lymph nodes | 79 | 29 | 36.71 (29/79) a |
Spleen | 93 | 22 | 23.66 (22/93) a |
Lung | 62 | 9 | 14.52 (9/62) b |
Pleural effusion | 57 | 13 | 22.81 (13/57) a |
Serum | 102 | 15 | 14.71 (15/102) b |
Total | 393 | 88 | 22.39 (88/393) |
Note: Different superscript letters (a, b) in one column means significant difference (P < 0.05)
A randomly chosen sample that showed positive PCR results was selected from each Xinjiang provincial region, and PCR amplification of the PCV3 full-length
PCV3-specific nucleic acids were detected in samples from nine commercial pig farms in Xinjiang province (Fig. 1B, Supplementary Fig.1). The prevalence of PCV3 in pig farms was 100.0% (12/12), while in all the tested samples it was 22.39% (88/393). The detection rate of PCV3 in different commercial pig farms ranged from 15.79% to 28.30% (Supplementary Table 1). By sample type 14.52–36.71% of tested material was positive. Among them, the detection rate was the highest in lymph nodes (36.71%, 29/79), which was significantly different from lung and serum samples (P < 0.05) (Table 3). The PCR results indicated that PCV3 infection was common in the commercial pig farms of Xinjiang.
The
Among 52 epidemic strains of PCV3 from different regions of the world (Supplementary Table 2), 73 nucleotide variation sites in the
Phylogenetic analysis based on the
Genetic diversity of PCV3 strains circulating in commercial pig farms in Xinjiang province, China
PCV3 strains | Group | Subgroup |
---|---|---|
CN/Xinjiang-SH6/2018 | 1 | 1.1 |
CN/Xinjiang-TA36/2018 | 1 | 1.1 |
CN/Xinjiang-AL5/2018 | 1 | 1.2 |
CN/Xinjiang-UR22/2018 | 1 | 1.1 |
CN/Xinjiang-YI7/2018 | 2 | 2.1 |
CN/Xinjiang-CH29/2018 | 2 | 2.2 |
CN/Xinjiang-AK16/2018 | 2 | 2.1 |
CN/Xinjiang-KO17/2018 | 2 | 2.2 |
CN/Xinjiang-KA2/2018 | 1 | 1.1 |
The GenBank accession numbers of 52 strains PCV3 are given in Table 1.
PCV2 is still one of the most important viruses threatening the pig industry (11, 20). Due to the widespread use of commercial vaccines in Chinese pig herds, PCV2 infection has been controlled to some extent (31). However, since PCV3 was first discovered in 2016, PCV3 infection has occurred on pig farms in more than 10 provinces including Jiangxi, Hubei, Henan, Chongqing, Fujian, Guangdong, Hunan, and Jiangsu, causing great damage to the Chinese pig industry (3, 16, 18, 19, 24, 27). Some studies showed that PCV3 infection was associated with abortion, respiratory failure, and diarrhoea in weaned piglets (10, 31); however, the pathogenesis of PCV3 was still unclear (5, 13). Therefore, it was urgent and necessary to carry out studies on the mechanisms of PCV3 infection, pathogenesis, and immunity (14, 15, 17).
The intensive pig farming system may contribute to the rapid spread of various infectious pathogens. In addition, the global trade in breeding pigs, semen, and pork also has important impact on the global spread of PCV (2, 22, 24). In this study, we examined samples from animals with clinical lesions in Xinjiang province, China. It was shown that PCV3 infection had occurred in pig populations, which may be related to the introduction of a large number of breeding pigs into Xinjiang from foreign countries and domestic provinces in recent years. Among the tested samples, PCV3 could be detected from lymph nodes, spleens, lungs, pleural effusion, and serum, the lymph nodes yielding very high detectable content. Assessment of the risk of PCV3 transmission and exploration of its role in cases of unknown aetiologies is an exigent need. It was reported that PCV3 could also infect pigs without any clinical lesions, and latent infection should consequently be further investigated in pigs without any clinical lesions.
The genetic and traceability analyses of PCV3 epidemic strains are of great significance for preventing and controlling this infectious disease (17, 18, 22). In this study, the nucleotide sequences of the
In summary, the present study demonstrated for the first time that PCV3 infection was common in commercial pig herds and had significant genetic diversity. Therefore, biosecurity should be a strengthened component in pig farm anti-epidemic measures, and disinfection regulations should be strictly enforced. Furthermore, breeding pigs should be quarantined before introduction to prevent PCV3 from spreading through long-distance cross-border transportation.