Cytotoxic and apoptotic effect of nanoclinoptilolite on canine osteosarcoma cell lines
Published Online: Oct 08, 2020
Page range: 589 - 596
Received: Dec 06, 2019
Accepted: Sep 23, 2020
DOI: https://doi.org/10.2478/jvetres-2020-0063
Keywords
© 2020 P.A. Ulutaş et al. published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.
Fig. 1
Fig. 2
Fig. 3
Primer sequences used for qRT-PCR
| NCBI reference sequence | Gene | Forward primer (5´→3´) | Reverse primer (5´→3´) |
|---|---|---|---|
| AGTCAAGGCTGAGAACGGGAAA | TCCACAACATACTCAGCACCAGC | ||
| NM_001002949.1 | CATGCCAAGAGGGAAACACCAGAA | GTGCTTTGCATTCTTGGATGAGGG | |
| NM_001003011.1 | TTCCGAGTGGCAGCTGAGATGTTT | TGCTGGCAAAGTAGAAGAGGGCAA | |
Effect of nanoclinoptilolite on cell viability of canine D-17 OSA. The results represent the mean ± standard deviation
| Nanoclinoptilolite concentration (μg/mL) | 24 h | 48 h | 72 h | ||||||
|---|---|---|---|---|---|---|---|---|---|
| % Viability | X | P | % Viability | X | P | % Viability | X | P | |
| Control | 100 ± 5.66 | Statistical difference between groups with different letters in the same column is significant | 100 ± 6.09 | Statistical difference between groups with different letters in the same column is significant | 100 ± 3.15 | Statistical difference between groups with different letters in the same column is significant | |||
| 10 | 92.62 ± 8.29 | Statistical difference between groups with different letters in the same column is significant | >0.05 | 60.24 ± 5.50 | Statistical difference between groups with different letters in the same column is significant | *** | 56.08 ± 3.57 | Statistical difference between groups with different letters in the same column is significant | *** |
| 20 | 81.45 ± 5.11 | Statistical difference between groups with different letters in the same column is significant | *** | 48.50 ± 1.83 | Statistical difference between groups with different letters in the same column is significant | *** | 31.95 ± 2.24 | Statistical difference between groups with different letters in the same column is significant | *** |
| 30 | 69.35 ± 2.24 | Statistical difference between groups with different letters in the same column is significant | *** | 37.27 ± 2.25 | Statistical difference between groups with different letters in the same column is significant | *** | 23.23 ± 6.89 | Statistical difference between groups with different letters in the same column is significant | *** |
| 40 | 61.66 ± 3.01 | Statistical difference between groups with different letters in the same column is significant | *** | 30.12 ± 2.23 | Statistical difference between groups with different letters in the same column is significant | *** | 19.87 ± 5.45 | Statistical difference between groups with different letters in the same column is significant | *** |
| 50 | 56.88 ± 2.45 | Statistical difference between groups with different letters in the same column is significant | *** | 26.16 ± 4.14 | Statistical difference between groups with different letters in the same column is significant | *** | 15.14 ± 7.29 | Statistical difference between groups with different letters in the same column is significant | *** |
| 75 | 51.92 ± 2.02 | Statistical difference between groups with different letters in the same column is significant | *** | 21.19 ± 0.42 | Statistical difference between groups with different letters in the same column is significant | *** | 12.02 ± 1.70 | Statistical difference between groups with different letters in the same column is significant | *** |
| 100 | 48.08 ± 1.87 | Statistical difference between groups with different letters in the same column is significant | *** | 19.14 ± 1.55 | Statistical difference between groups with different letters in the same column is significant | *** | 10.31 ± 0.26 | Statistical difference between groups with different letters in the same column is significant | *** |
| 150 | 44.60 ± 1.80 | Statistical difference between groups with different letters in the same column is significant | *** | 18.19 ± 0.53 | Statistical difference between groups with different letters in the same column is significant | *** | 9.41 ± 0.15 | Statistical difference between groups with different letters in the same column is significant | *** |
| 200 | 43.80 ± 3.91 | Statistical difference between groups with different letters in the same column is significant | *** | 18.00 ± 0.74 | Statistical difference between groups with different letters in the same column is significant | *** | 9.92 ± 0.28 | Statistical difference between groups with different letters in the same column is significant | *** |
Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 24 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells
| % live | % apoptotic | % dead | |
|---|---|---|---|
| Control | 92.3 ± 2.36 Statistical difference between groups with different letters in the same column is significant | 7.62 ± 1.83 Statistical difference between groups with different letters in the same column is significant | 0.12 ± 0.017 Statistical difference between groups with different letters in the same column is significant |
| 10 μg/mL | 93.65 ± 1.61 Statistical difference between groups with different letters in the same column is significant | 5.78 ± 0.87 Statistical difference between groups with different letters in the same column is significant | 0.57 ± 0.18 Statistical difference between groups with different letters in the same column is significant |
| 20 μg/mL | 91.57 ± 0.43 Statistical difference between groups with different letters in the same column is significant | 7.60 ± 0.32 Statistical difference between groups with different letters in the same column is significant | 0.95 ± 0.004 Statistical difference between groups with different letters in the same column is significant |
| 30 μg/mL | 86.65 ± 0.41 Statistical difference between groups with different letters in the same column is significant | 12.77 ± 0.51 Statistical difference between groups with different letters in the same column is significant | 0.52 ± 0.07 Statistical difference between groups with different letters in the same column is significant |
| P | 0.020 | 0.031 | 0.05 |
Effect of nanoclinoptilolite on the Bax/Bcl-2 ratio in canine D-17 OSA cells for 24 and 48 h (* P<0.05)
| Nanoclinoptilolite concentration | 24 h | 48 h |
|---|---|---|
| 10 μg/mL | 0.44 | 3.00 |
| 20 μg/mL | 0.44 | 8.88 |
| 30 μg/mL | 0.75 | 14.24 |
Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 48 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells
| % live | % apoptotic | % dead | |
|---|---|---|---|
| Control | 92.63 ± 0.63 Statistical difference between groups with different letters in the same column is significant | 7.25 ± 0.73 Statistical difference between groups with different letters in the same column is significant | 0.22 ± 0.04 Statistical difference between groups with different letters in the same column is significant |
| 10 g/mL | 91.3 ± 0.41 Statistical difference between groups with different letters in the same column is significant | 8.53 ± 0.93 Statistical difference between groups with different letters in the same column is significant | 0.17 ± 0.02 Statistical difference between groups with different letters in the same column is significant |
| 20 μg/mL | 85.35 ± 0.30 Statistical difference between groups with different letters in the same column is significant | 14.2 ± 0.5 Statistical difference between groups with different letters in the same column is significant | 0.45 ± 0.09 Statistical difference between groups with different letters in the same column is significant |
| 30 μg/mL | 23.8 ± 1.96 Statistical difference between groups with different letters in the same column is significant | 23.8 ± 1.93 Statistical difference between groups with different letters in the same column is significant | 1.2 ± 0.03 Statistical difference between groups with different letters in the same column is significant |
| P | 0.020 | 0.031 | 0.05 |