Diversity in the aetiology of cancer poses a challenge in determining a definitive treatment method and achieving results. Surgical intervention, administration of chemotherapeutic drugs, radiotherapy, immunotherapy, and alternative medicine to strengthen the immune system and support the treatment administered are all used in cancer regimens. Administration of immunostimulatory agents such as plant extracts or zeolites containing different antioxidants and investigation of their anti-cancer effects have been the major topics studied in recent years.
Osteosarcoma (OSA), common in dogs and especially in large breeds, accounts for 85% of all skeletal tumours (12, 30). OSA develops in the metaphyseal region of canine long bones and sometimes in the ribs and skull. The most common locations are the distal radius, proximal humerus, proximal tibia, distal tibia, and distal femur (21). No long-term survival has been achieved by standard chemotherapy for OSA in dogs due to the metastatic nature of this type of cancer (20, 26, 30). Osteosarcoma is very aggressive and frequently causes secondary tumours. At the time of diagnosis, there is usually one more tumour other than the primary location. Therefore, the standard treatment for bone cancer is the surgical removal of the primary tumour, followed by destruction of the remaining tumour cells with chemotherapy (26, 30).
Although the incidence of the disease is about ten times higher in the dog population than in humans, OSA is also the most common form of malignant bone cancer in children (13). Both clinical and molecular evidence has shown that OSA shares many common characteristics in humans and dogs such as anatomical location, presence of histopathologically diagnosed metastatic disease, development of chemotherapy-resistant metastases and altered expression/activation (5). In addition, overlapping transcriptional profiles and DNA copy-number variations in dogs and children have suggested that these diseases may also have significant similarity at the molecular level (5). Therefore, the studies conducted in the field of canine OSA have been considered to have possible value for research into human OSA in terms of study model and drug development.
Zeolites have unique and extraordinary physical and chemical properties. Clinoptilolite is a natural, nontoxic zeolite with ion exchange and adsorbent properties (23). Recently, studies on the use of clinoptilolite in veterinary and human medicine have been conducted. The antidiarrhoeic property is the best-known biological activity of natural clinoptilolite (27). It has been reported that it absorbs glucose very effectively (10) and has an immunostimulatory effect (2, 23, 24, 32). Also, some results show that silicates and aluminosilicates cause alterations in the expression of genes of proteins involved in cell signalling (23). Silicate particles ingested by cells have been reported to stimulate mitogen-activated protein kinase (MAPK), protein kinase C, and stress-activated protein kinases (SAPKs) (18). Moreover, they also activate important transcription factors such as activator protein-1 (AP-1) and NF-κB (nuclear factor kappa-light-chain-enhancer of activated B cells), and proinflammatory cytokines such as IL-lα, IL-6, and TNF (31). The anti-cancer effects of clinoptilolite have been demonstrated on
In the field of healthcare, nanodrug formulations can easily move across the blood–brain barrier and be used for therapeutic purposes due to their very small size (3, 4, 8, 15, 29). Preliminary studies on the use of nanoproducts have been performed in cell cultures and then performed on experimental animals. In this study, clinoptilolite nanoparticulated using chitosan biopolymer was added to canine OSA cell culture to investigate its effects on cells. This study aimed to determine the cytotoxic and apoptotic effects of nanoclinoptilolite administered to a canine OSA cell line and to evaluate its effects on apoptosis.
In this study, clinoptilolite was encapsulated into nanoparticles prepared using chitosan biopolymer. For this purpose, nanoparticle synthesis was carried out in a spray drier using 1% chitosan, clinoptilolite solution, and thiaminpyrophosphate acetic acid. During the optimisation and characterisation of the nanoparticles obtained, size measurements were made with a Zetasizer Nano ZS90 particle size analyser (Malvern Panalytical, Malvern, UK). Nanoparticle synthesis was performed by Nanovet (Izmir, Turkey).
The expression levels of
Primer sequences used for qRT-PCR
NCBI reference sequence | Gene | Forward primer (5´→3´) | Reverse primer (5´→3´) |
---|---|---|---|
AGTCAAGGCTGAGAACGGGAAA | TCCACAACATACTCAGCACCAGC | ||
NM_001002949.1 | CATGCCAAGAGGGAAACACCAGAA | GTGCTTTGCATTCTTGGATGAGGG | |
NM_001003011.1 | TTCCGAGTGGCAGCTGAGATGTTT | TGCTGGCAAAGTAGAAGAGGGCAA |
The effect of nanoclinoptilolite on canine OSA cell viability was evaluated by the MTT method. Exposure of canine D-17 OSA cells to nanoclinoptilolite resulted in a statistically significant decrease in viable cells in a time- and dose-dependent manner (Fig. 1 and Table 2). IC50 values of the cells were 35.64 μg/mL, 26.29μg/mL, and 7.99 μg/mL at 24, 48, and 72 h, respectively.
Effect of nanoclinoptilolite on cell viability of canine D-17 OSA. The results represent the mean ± standard deviation
Nanoclinoptilolite concentration (μg/mL) | 24 h | 48 h | 72 h | ||||||
---|---|---|---|---|---|---|---|---|---|
% Viability | X | P | % Viability | X | P | % Viability | X | P | |
Control | 100 ± 5.66 | Statistical difference between groups with different letters in the same column is significant | 100 ± 6.09 | Statistical difference between groups with different letters in the same column is significant | 100 ± 3.15 | Statistical difference between groups with different letters in the same column is significant | |||
10 | 92.62 ± 8.29 | Statistical difference between groups with different letters in the same column is significant | >0.05 | 60.24 ± 5.50 | Statistical difference between groups with different letters in the same column is significant | *** | 56.08 ± 3.57 | Statistical difference between groups with different letters in the same column is significant | *** |
20 | 81.45 ± 5.11 | Statistical difference between groups with different letters in the same column is significant | *** | 48.50 ± 1.83 | Statistical difference between groups with different letters in the same column is significant | *** | 31.95 ± 2.24 | Statistical difference between groups with different letters in the same column is significant | *** |
30 | 69.35 ± 2.24 | Statistical difference between groups with different letters in the same column is significant | *** | 37.27 ± 2.25 | Statistical difference between groups with different letters in the same column is significant | *** | 23.23 ± 6.89 | Statistical difference between groups with different letters in the same column is significant | *** |
40 | 61.66 ± 3.01 | Statistical difference between groups with different letters in the same column is significant | *** | 30.12 ± 2.23 | Statistical difference between groups with different letters in the same column is significant | *** | 19.87 ± 5.45 | Statistical difference between groups with different letters in the same column is significant | *** |
50 | 56.88 ± 2.45 | Statistical difference between groups with different letters in the same column is significant | *** | 26.16 ± 4.14 | Statistical difference between groups with different letters in the same column is significant | *** | 15.14 ± 7.29 | Statistical difference between groups with different letters in the same column is significant | *** |
75 | 51.92 ± 2.02 | Statistical difference between groups with different letters in the same column is significant | *** | 21.19 ± 0.42 | Statistical difference between groups with different letters in the same column is significant | *** | 12.02 ± 1.70 | Statistical difference between groups with different letters in the same column is significant | *** |
100 | 48.08 ± 1.87 | Statistical difference between groups with different letters in the same column is significant | *** | 19.14 ± 1.55 | Statistical difference between groups with different letters in the same column is significant | *** | 10.31 ± 0.26 | Statistical difference between groups with different letters in the same column is significant | *** |
150 | 44.60 ± 1.80 | Statistical difference between groups with different letters in the same column is significant | *** | 18.19 ± 0.53 | Statistical difference between groups with different letters in the same column is significant | *** | 9.41 ± 0.15 | Statistical difference between groups with different letters in the same column is significant | *** |
200 | 43.80 ± 3.91 | Statistical difference between groups with different letters in the same column is significant | *** | 18.00 ± 0.74 | Statistical difference between groups with different letters in the same column is significant | *** | 9.92 ± 0.28 | Statistical difference between groups with different letters in the same column is significant | *** |
* P < 0.05; ** P < 0.01; *** P < 0.001 compared to control
There was no statistically significant difference in caspase-3 and -7 activity in cells inoculated with 10 μg/mL and 20 μg/mL concentrations of clinoptilolite for 24 h, compared to the control. However, there was a statistically significant increase in this activity in cells to which a 30 μg/mL concentration of nanoclinoptilolite was added. The percentage of early apoptotic cells induced by this concentration increased to 6.20% and for late apoptotic cells it increased to 6.57%. The total apoptotic cell content was determined at 12.77% and that of dead cells at 0.52% (Table 3, Fig. 2 A–D). Canine D-17 OSA cells treated with a 10 μg/mL concentration of nanoclinoptilolite for 48 h showed no statistically significant difference when compared to the control. However, the percentage of early apoptotic cells induced by 20 μg/mL and 30 μg/mL concentrations of nanoclinoptilolite increased to 4.48% and 8.95%, and the percentage of late apoptotic cells increased to 9.73% and 14.85%, respectively (Table 4, Fig. 2 E–G).
Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 24 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells
% live | % apoptotic | % dead | |
---|---|---|---|
Control | 92.3 ± 2.36 Statistical difference between groups with different letters in the same column is significant | 7.62 ± 1.83 Statistical difference between groups with different letters in the same column is significant | 0.12 ± 0.017 Statistical difference between groups with different letters in the same column is significant |
10 μg/mL | 93.65 ± 1.61 Statistical difference between groups with different letters in the same column is significant | 5.78 ± 0.87 Statistical difference between groups with different letters in the same column is significant | 0.57 ± 0.18 Statistical difference between groups with different letters in the same column is significant |
20 μg/mL | 91.57 ± 0.43 Statistical difference between groups with different letters in the same column is significant | 7.60 ± 0.32 Statistical difference between groups with different letters in the same column is significant | 0.95 ± 0.004 Statistical difference between groups with different letters in the same column is significant |
30 μg/mL | 86.65 ± 0.41 Statistical difference between groups with different letters in the same column is significant | 12.77 ± 0.51 Statistical difference between groups with different letters in the same column is significant | 0.52 ± 0.07 Statistical difference between groups with different letters in the same column is significant |
P | 0.020 | 0.031 | 0.05 |
Live/apoptotic/necrotic cell ratios in canine D-17 OSA cells treated for 48 h with 10, 20, and 30 μg/mL of nanoclinoptilolite and in control group cells
% live | % apoptotic | % dead | |
---|---|---|---|
Control | 92.63 ± 0.63 Statistical difference between groups with different letters in the same column is significant | 7.25 ± 0.73 Statistical difference between groups with different letters in the same column is significant | 0.22 ± 0.04 Statistical difference between groups with different letters in the same column is significant |
10 g/mL | 91.3 ± 0.41 Statistical difference between groups with different letters in the same column is significant | 8.53 ± 0.93 Statistical difference between groups with different letters in the same column is significant | 0.17 ± 0.02 Statistical difference between groups with different letters in the same column is significant |
20 μg/mL | 85.35 ± 0.30 Statistical difference between groups with different letters in the same column is significant | 14.2 ± 0.5 Statistical difference between groups with different letters in the same column is significant | 0.45 ± 0.09 Statistical difference between groups with different letters in the same column is significant |
30 μg/mL | 23.8 ± 1.96 Statistical difference between groups with different letters in the same column is significant | 23.8 ± 1.93 Statistical difference between groups with different letters in the same column is significant | 1.2 ± 0.03 Statistical difference between groups with different letters in the same column is significant |
P | 0.020 | 0.031 | 0.05 |
Expression of BAX (pro-apoptotic) and BCL-2 (anti-apoptotic) proteins was determined by RT-PCR to investigate the apoptotic effect, and BAX/BCL-2 ratios were calculated. There was no significant change in BAX/BCL-2 ratios compared to the control (0 μM) over the 24-h incubation period (data not shown). At the end of 48-h incubation with nanoclinoptilolite, the BAX/BCL-2 ratio was found to be 3.00-, 8.88-, and 14.24-fold higher compared with the control cells for 10, 20, and 30 μg/mL of nanoclinoptilolite doses, respectively (Table 5, Fig. 3).
Effect of nanoclinoptilolite on the Bax/Bcl-2 ratio in canine D-17 OSA cells for 24 and 48 h (* P<0.05)
Nanoclinoptilolite concentration | 24 h | 48 h |
---|---|---|
10 μg/mL | 0.44 | 3.00 |
20 μg/mL | 0.44 | 8.88 |
30 μg/mL | 0.75 | 14.24 |
The biological activities of clinoptilolite include glucose absorption, diarrhoea symptom relief, and immune response stimulation (16). It was shown that chitosan-coated clinoptilolite nanoparticles statistically significantly decreased canine D-17 OSA cell viability at 24, 48, and 72 h. There are various studies administering clinoptilolite to cancer cells in pure form (6, 16, 23, 24). In these studies, the researchers challenged cancer cells with clinoptilolite and investigated various pathways in cancer cell lines. Pavlevic
Chitosan is a molecule used in the fields of biotechnology and pharmaceutics. Coating drug nanoparticles with it improves drug delivery systems (3, 15). A chitosan-coated nanoparticular form increases the specificity and bioavailability of drugs and reduces the toxicity of drugs used in the treatment of cancer (15). This polysaccharide has many important biological properties, including bioactivity, biodegradability, and biocompatibility with reactive chemical groups containing NH2 and OH (3). Previous studies have confirmed that some types of nanoparticles can prevent the proliferation of cancer cells and that apoptosis of cancer cells is associated with reactive oxygen species– mediated (ROS-mediated) pathways (15). In this study, clinoptilolite, which is a natural product itself, was coated with a natural polymer, chitosan, and made to interact with cancer cells. Ali
Caspases play an important role in the apoptotic process. During apoptosis, caspase activity causes damage in DNA, leading to further destruction of cellular components by changing cell morphology. In this study, it was found that 24 h incubation of a D-17 cell culture in which nanoclinoptilolite was administered at different doses increased the apoptotic cell rate at a dose of 30 μg/mL, while 48 h incubation effectively induced apoptosis at both 20 μg/mL and 30 μg/mL doses. This effect of nanoclinoptilolite on D-17 cells was observed to occur through the caspase-3 and -7 activity. Nanoclinoptilolite demonstrates this effect by interacting with multiple molecular targets, and this occurs by activation of biochemical pathways that induce apoptosis. The BCL-2 family are proteins involved in the regulation of apoptosis and act by suppressing or stimulating cell death (11). BAX protein is a member of the BCL-2 family that induces apoptosis, whereas BCL-2 blocks programmed cell death without affecting cellular proliferation (28). The balance between pro-apoptotic and anti-apoptotic proteins can determine the occurrence of apoptosis. Downregulation of BCL-2 expression may result in an increase in the BAX/BCL-2 ratio and an increase in free BAX. In such case, BAX activates apoptotic cascades by undergoing translocation in the mitochondria (1). In this study, it was found that 24 h incubation of different doses of nanoclinoptilolite did not cause a significant change in the BAX/BCL-2 ratio. However, following 48 h of incubation, it induced apoptosis by causing a 3-, 8.8-, and 14.4-fold increase in the BAX/BCL-2 ratio at doses of 10, 20, and 30 μg/mL, respectively. Consequently, it was determined that nanoclinoptilolite changed the ratio between BAX and BCL-2 in favour of apoptosis after 48 h of incubation. This rate is an important predictor demonstrating the activation of the mitochondrial apoptotic pathway and is used for this purpose in studies (14, 17, 33).
In conclusion, the polymer chitosan as a drug delivery system is currently widely favoured as an effective and useful nanoparticular material. Clinoptilolite, a natural zeolite, was converted into a nanoparticle in this study by encapsulation with chitosan. To determine its effect on cancer cells, it was administered to canine OSA cells at different doses and durations, and its influence on cell proliferation and apoptosis was determined for each dose and duration. It was found that the nanoparticular form of clinoptilolite, which in ordinary particular form was previously demonstrated to have anticancer properties by decreasing cell viability, effectively and rapidly increased apoptotic cell ratio and exhibited this effect by causing an increase in BAX/BCL-2 ratio. In addition, it was concluded that nanoclinoptilolite showed this effect at much lower doses compared to the levels at which it was used in its pure form in the previous studies.