Single nucleotide polymorphisms in genes  and  as prognostic factors in resectable colorectal cancer

Matej Horvat; Uros Potocnik; Katja Repnik; Rajko Kavalar; Vesna Zadnik; Stojan Potrc; Borut Stabuc

Open Access

Single nucleotide polymorphisms in genes MACC1, RAD18, MMP7 and SDF-1a as prognostic factors in resectable colorectal cancer

and

| Sep 08, 2016

Radiology and Oncology

Volume 51 (2017): Issue 2 (June 2017)

About this article

Cite

Published Online: Sep 08, 2016

Page range: 151 - 159

Received: Feb 05, 2016

Accepted: May 27, 2016

DOI: https://doi.org/10.1515/raon-2016-0043

© 2017 Matej Horvat, Uros Potocnik, Katja Repnik, Rajko Kavalar, Vesna Zadnik, Stojan Potrc, Borut Stabuc

This article is distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Survival analysis curves for different genotype groups of CRC patients according to SNP rs1990172 in gene MACC1.

Survival analysis curves for different genotype groups of CRC patients according to SNP rs373572 in gene RAD18.

Clinical and pathohistological characteristics of patients included in study

Clinical and histopathological characteristics	CRC patients (N = 163)
Sex
Male/female, N(%)	92/71 (56.4/43.6)
Age at diagnosis
Mean +/- SD	67.28 +/- 11.44
Stage of disease, N (%)
I	29 (17.8)
II	81 (49.7)
III	53 (32.5)
TNM staging
Tumour, N (%)
T1	8 (4.9)
T2	24 (14.7)
T3	120 (73.6)
T4	11 (6.7)
Lymph nodes, N (%)
N0	110 (67.5)
N1	38 (23.3)
N2	15 (9.2)
Vital status (5.10.2015), N (%)
dead	65 (39.9) (42 due to CRC
	progression, 23 other cause)
alive	98 (60.1)
Disease progression, N (%)
yes	46 (28.2) (42 dead, 4 alive)
no	117 (71.8)
Disease progression according to stage, N (%)
stage I	5 (17.2)
stage II	18 (22.2)
stage III	23 (43.4)
Clinical characteristics, N (%)
more than 12 lymph nodes resected	70 (42.9)
adjuvant therapy	41 (25.2)
Differentiation grade, N (%)
I	66 (40.5)
II	74 (45.4)
III	21 (12.9)
no data	2 (1.2)
Perineural invasion, N (%)
yes	13 (8.0)
no	150 (92.0)
Lymphovascular invasion, N (%)
yes	27 (16.6)
no	136 (83.4)

Associations between selected SNPs and clinico-histopathological characteristics of patients

			TNM staging				Grade of differentiation		Perineural invasion		Lymphovascular invasion
Gene/ SNP ID	Frequency		T1+T2	T3+T4	N0	N1+N2	1+2	3	No	Yes	No	Yes
CXCL12 rs1801157	AA	4.76	0.0	5.9	7.3	0.0	4.8	5.3	5.2	0.0	5.8	0.0
	AG	29.25	31.0	28.8	26.0	35.3	27.8	42.1	29.9	23.1	27.3	38.5
	GG	65.99	69.0	65.3	66.7	64.7	67.5	52.6	64.9	76.9	66.9	61.5
	Statistical analysis		0.346		0.096		1.000		1.000		0.354		p-value	AA vs AG+GG
			1.261		1.573		0.900		1.102		1.228		OR
			1.159–1.373		1.388–1.783		0.102–7.916		1.045–1.162		1.135–1.329		95% CI
			0.828		1.000		0.303		0.543		0.656		p-value	AA+AG vs GG
			0.814		0.960		0.556		1.860		0.820		OR
			0.340–1.948		0.471–1.958		0.210–1.471		0.488–7.089		0.342–1.967		95% CI
MACC1 rs1990172	GG	5.84	12.0	4.5	7.8	2.1	5.2	5.3	5.6	7.7	7.1	0.0
	GT	36.50	52.0	33.0	37.8	34.0	37.9	26.3	38.7	15.4	35.4	41.7
	TT	57.66	36.0	62.5	54.4	63.8	56.9	68.4	55.6	76.9	57.5	58.3
	Statistical analysis		0.024		0.363		1.000		0.560		0.350		p-value	GG vs GT+TT
			2.963		1.477		0.982		0.718		1.229		OR
			1.202–7.301		0.715–3.050		0.112–8.641		0.081–6.338		1.131–1.334		95% CI
			0.263		0.160		0.453		0.237		1.000		p-value	GG+GT vs TT
			3.880		2.918		1.641		2.657		1.034		OR
			0.463–32.516		0.649–13.119		0.583–4.620		0.697–10.127		0.523–2.525		95% CI
MMP7 rs11568818	AA	27.27	28.6	27.0	28.1	25.5	27.9	26.3	26.7	33.3	27.7	25.0
	AG	47.55	64.3	43.5	52.1	38.3	47.5	52.6	48.9	33.3	51.3	29.2
	GG	25.17	7.1	29.6	19.8	36.2	24.6	21.1	24.4	33.3	21.0	45.8
	Statistical analysis		1.000		0.843		1.000		0.736		1.000		p-value	AA vs AG+GG
			1.084		1.141		1.082		0.729		1.151		OR
			0.433–2.713		0.517–2.521		0.362–3.234		0.207–2.573		0.420–3.152		95% CI
			0.014		0.041		1.000		0.497		0.018		p-value	AA+AG vs GG
			5.457		2.296		0.818		1.547		3.182		OR
			1.226–24.284		1.054–5.002		0.252–2.654		0.437–5.479		1.273–7.952		95% CI
RAD18 rs373572	AA	51.59	46.7	52.8	48.6	58.0	50.4	55.0	50.7	61.5	51.9	50.0
	AG	38.22	33.3	39.4	41.1	32.0	39.3	35.0	39.6	23.1	38.2	38.5
	GG	10.19	20.0	7.9	10.3	10.0	10.4	10.0	9.7	15.4	9.9	11.5
	Statistical analysis		0.685		0.306		0.812		0.567		1.000		p-value	AA vs AG+GG
			0.784		0.685		0.830		0.643		1.079		OR
			0.353–1.739		0.348–1.348		0.323–2.133		0.201–2.058		0.465–2.504		95% CI
			0.085		1.000		1.000		0.624		0.731		p-value	AA+AG vs GG
			0.342		0.970		0.960		1.688		1.184		OR
			0.113–1.030		0.318–2.957		0.201–4.580		0.339–8.399		0.312–4.488		95% CI

Primer sequences used in PCR reaction, expected sizes of products, annealing temperatures, primer concentrations and genotyping method of selected SNPs; restriction enzymes and sizes of fragments after restriction for genotyping of SNPs rs1801157 (CXCL12) and rs1990172 (MACC1)

Gene	SNP ID	Forward and reverse primer	Product size [bp]	Annealing temperature [°C]	Primer concentration [nM]	Genotyping method
CXCL12	rs1801157 A/G	GTGGGATGGGATGGTGGAG CCTCAGCTCAGGGTAGCC	109	60	650	RFLP
MACC1	rs1990172 G/T	CAGGGAAAGAAATGGTTATTGCA GGAAAAGGAGGGAAGCATGTG	115	63	300	RFLP
MMP7	rs11568818 A/G	TGGAGTCAATTTATGCAGCAG CGAGGAAGTATTACATCGTTATTGG	93	57	250	HRM
RAD18	rs373572 A/G	TGTGATTAACCTAGTGGTTATTTTCTT GCATCCTAGTCTTCTCTATATTTTCG	85	60	300	HRM
Gene	SNP ID	Restriction enzyme	Size of fragments after restriction [bp]
CXCL12	rs1801157	MspI	AA: 109, AG: 109+62+47, GG: 62+47
MACC1	rs1990172	BseGI	GG: 80+35, GT: 105+80+35, TT: 105

eISSN:: 1581-3207
Language:: English

Publication timeframe:: 4 times per year
Journal Subjects:: Medicine, Clinical Medicine, Radiology, Internal Medicine, Haematology, Oncology

Journal RSS Feed

Single nucleotide polymorphisms in genes MACC1, RAD18, MMP7 and SDF-1a as prognostic factors in resectable colorectal cancer

Article Category: Research Articles

Published Online: Sep 08, 2016

Page range: 151 - 159

Received: Feb 05, 2016

Accepted: May 27, 2016

DOI: https://doi.org/10.1515/raon-2016-0043

© 2017 Matej Horvat, Uros Potocnik, Katja Repnik, Rajko Kavalar, Vesna Zadnik, Stojan Potrc, Borut Stabuc

This article is distributed under the terms of the Creative Commons Attribution Non-Commercial License, which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Clinical and pathohistological characteristics of patients included in study

Associations between selected SNPs and clinico-histopathological characteristics of patients

Primer sequences used in PCR reaction, expected sizes of products, annealing temperatures, primer concentrations and genotyping method of selected SNPs; restriction enzymes and sizes of fragments after restriction for genotyping of SNPs rs1801157 (CXCL12) and rs1990172 (MACC1)