Colorectal cancer (CRC) represents the third most common malignancy worldwide in men and second most common malignancy in women, accounting for approximately 10% of all tumour types worldwide and 8% of cancer related mortality.1 In Slovenia according to Cancer registry of Slovenia yearly reports, CRC is the second most common cancer in men and women. The incidence was steadily increasing in the last decades. From 2001 to 2011 it has risen by 35%, from 1110 in 2001 to 1709 in 2010 when it reached its peak. The incidence is now declining with 1530 in 2012. There is also a relative proximal shift of tumour location with the incidence of colon cancer increasing faster than the incidence of rectal cancer.2–5
The survival of CRC is improving as a consequence of screening programs, new chemotherapy regimens and targeted treatments as well as improved surgical treatment of metastatic disease. According to Surveillance, Epidemiology, and End Results (SEER) register and a worldwide CONCORD-2 study, the 5-year CRC survival in developed countries is more than 60%.6, 7
CRC is a heterogeneous disease and its cancero-genesis a multistep process. CRC develops in 75% sporadically because of mutations acquired during a person’s lifetime and in 25% as a combination of hereditary syndromes, a higher risk because of CRC familial burden without criteria for a hereditary syndrome or as a consequence of inflammatory bowel syndrome.8 It evolves through distinct genetic pathways: chromosomal instability, microsatellite instability (MSI-H) and the CpG island methylator phenotype (CIMP). Next to »classical adenoma-carcinoma« sequence proposed by Fearon and Voglestein there is also a newly recognized »serrated neoplasia pathway«, where CRC evolves through different precancerous lesions, as for instance serrated adenoma.9 The carcinogenesis might also differ in regard to CRC arising either in right or left hemicolon.10
The current treatment for resectable CRC of stage I, II and III is surgical resection. For patients of stage I, surgical resection is the only recommended treatment without adjuvant chemotherapy. For patients of stage III adjuvant chemotherapy is recommended in all patients. In contrast for patients of stage II adjuvant chemotherapy is not recommended for unselected patients, but for those with clinical or pathological risk factors.11–13
Potential clinical and pathological risk factors for recurrence of stage II CRC have been investigated and incorporated in different guidelines, but a definite consensus has not yet been reached. According to European and American guidelines (The European Society for Medical Oncology (ESMO), The American Society of Clinical Oncology (ASCO) and The National Comprehensive Cancer Network (NCCN)), negative prognostic risk factors according to all three sets of guidelines are: T4 tumours, bowel perforation, extension of surgical lymphadenectomy, inadequate pathological sampling of lymph nodes and poor tumour differentiation grade. Further negative prognostic markers included in one or two sets of guidelines are: bowel obstruction, lymphovascular invasion and/or perineural invasion and indeterminate or positive margins. Consensus on them has not been reached yet. There is no clear message regarding adjuvant chemotherapy patient selection in stage II CRC.11–13
Although stage I and early stage II CRC are prognostically very favourable, with a small burden of disease, a proportion of these tumours have certain characteristics, making them clinically more malignant and therefore predisposing them to disease recurrence or metachronous colon cancer.9 Up to 30% of patients with stage I and up to 50% of patients with stage II of CRC are going to relapse.14, 15 Considering these facts it is clear that classical TNM staging system has its limitations, so it is necessary to determine molecular or immuno-logical prognostic and predictive markers to implement in routine clinical practice.16, 17
Single nucleotide polymorphisms (SNPs) are molecular factors that might be useful as prognostic markers in CRC. Preliminary genome wide association (GWA) study in non-caucasian population has indicated a role of SNPs in resectable CRC.18 We hypothesized that SNPs participating in genetic risk for CRC and metastasis might prove as a prognostic factor in resectable CRC. In our study, we have selected SNPs with higher frequency in patients with either local lymph node involvement or systemic dissemination in genes participating in CRC carcinogenesis and disease dissemination:
We have conducted a study, regarding the role of selected SNPs in resectable CRC. In total, 163 consecutive patients treated surgically at University Medical Centre in Maribor in years 2007 and 2008 have been investigated. The inclusion criterion was colorectal adenocarcinoma of stages I, II or III. The exclusion criteria were: history of inflammatory bowel disease, preoperative chemoradiotherapy/radiotherapy, perioperative mortality within 30 days and confirmed familial CRC (FAP, HNPCC or other familial syndromes). Mean age of the patients at diagnosis was 67 years +/- 11.4 years (range 26–88 years). Clinical and pathohistological characteristics examined were: age, gender, TNM stage, differentiation grade, perineural invasion and lymphovascular invasion. Time to progression was defined as time from diagnosis to progression. Patients were followed-up on average for 69 months. Data regarding their vital status was acquired from Cancer registry of Slovenia. Clinical and pathohistological characteristics of patients and tumours are summarized in Table 1.
Clinical and pathohistological characteristics of patients included in study
Clinical and histopathological characteristics | CRC patients ( |
---|---|
Sex | |
Male/female, | 92/71 (56.4/43.6) |
Age at diagnosis | |
Mean +/- SD | 67.28 +/- 11.44 |
Stage of disease, | |
I | 29 (17.8) |
II | 81 (49.7) |
III | 53 (32.5) |
TNM staging | |
T1 | 8 (4.9) |
T2 | 24 (14.7) |
T3 | 120 (73.6) |
T4 | 11 (6.7) |
N0 | 110 (67.5) |
N1 | 38 (23.3) |
N2 | 15 (9.2) |
Vital status (5.10.2015), | |
dead | 65 (39.9) (42 due to CRC |
progression, 23 other cause) | |
alive | 98 (60.1) |
Disease progression, | |
yes | 46 (28.2) (42 dead, 4 alive) |
no | 117 (71.8) |
Disease progression according to stage, | |
stage I | 5 (17.2) |
stage II | 18 (22.2) |
stage III | 23 (43.4) |
Clinical characteristics, | |
more than 12 lymph nodes resected | 70 (42.9) |
adjuvant therapy | 41 (25.2) |
Differentiation grade, | |
I | 66 (40.5) |
II | 74 (45.4) |
III | 21 (12.9) |
no data | 2 (1.2) |
Perineural invasion, | |
yes | 13 (8.0) |
no | 150 (92.0) |
Lymphovascular invasion, | |
yes | 27 (16.6) |
no | 136 (83.4) |
DNA was extracted from the formalin-fixed paraffin-embedded (FFPE) CRC tissues of 163 patients from the Department of Pathology, University Medical Centre in Maribor. FFPE tissues were prepared as follow: at macroscopic examination of resected specimen, the path olog ist sampled representative tissue samples (2 x 2 x 0.4 cm) from tumour, bowel wall outside the tumour and all lymph nodes from the resected pericolic or mesorectal fat. For determination of resection margin status, the representative tissue samples were taken also from the proximal and distal intestinal resection margin, from circumferential resection margin and dyed with the indian-ink. All representative tissue samples and all obtained lymph nodes were put into labeled histo-casettes and standardly processed in automated histoprocessors (dehydrated and paraffined). Paraffined tissue samples were embedded in paraffin blocks. For the extraction of DNA, 12μm thick tissue slices were cut with microtome from tumour tissue blocks.
DNA was isolated from FFPE tissues using BiOstic FFPE Tissue DNA Isolation Kit ®(MO BIO Laboratories, Inc.) according to manufacturer recommendations. SNPs of genes
Primer sequences used in PCR reaction, expected sizes of products, annealing temperatures, primer concentrations and genotyping method of selected SNPs; restriction enzymes and sizes of fragments after restriction for genotyping of SNPs rs1801157 (
Gene | SNP ID | Forward and reverse primer | Product size [bp] | Annealing temperature [°C] | Primer concentration [nM] | Genotyping method |
---|---|---|---|---|---|---|
rs1801157 A/G | GTGGGATGGGATGGTGGAG CCTCAGCTCAGGGTAGCC | 109 | 60 | 650 | RFLP | |
rs1990172 G/T | CAGGGAAAGAAATGGTTATTGCA GGAAAAGGAGGGAAGCATGTG | 115 | 63 | 300 | RFLP | |
rs11568818 A/G | TGGAGTCAATTTATGCAGCAG CGAGGAAGTATTACATCGTTATTGG | 93 | 57 | 250 | HRM | |
rs373572 A/G | TGTGATTAACCTAGTGGTTATTTTCTT GCATCCTAGTCTTCTCTATATTTTCG | 85 | 60 | 300 | HRM | |
rs1801157 | MspI | AA: 109, AG: 109+62+47, GG: 62+47 | ||||
rs1990172 | BseGI | GG: 80+35, GT: 105+80+35, TT: 105 |
Our study was approved by the National Ethics committee of Slovenia (clinical trial registration number: 65/02/13) and is listed at University Medical Centre Maribor as research project: IRP-2014/01-21.
The clinical endpoint of our trial was evaluating the role of selected SNPs as prognostic factors by determining disease-free survival from the date of the surgery. Kaplan-Meier survival curves were constructed and compared using the log-rank test. Multivariate analysis was carried out using a Cox proportional hazard model. Group distribution for each clinicopathological characteristic was compared using two-tailed Fischer exact test. Data are expressed as the mean +/- standard deviation. Statistical significance was defined as p < 0.05. All analyses were performed using SPSS.
Over an average follow-up period of 69 months, 65 deaths were recorded (39.9%). Out of those 65 patients, 42 died because of disease progression and 23 patients died of another cause.
Selected SNPs were genotyped in 163 CRC patients with well-defined clinical and histopathological characteristics. Genotype and allele frequencies were calculated for all patients and are shown in Table 3. When comparing selected SNPs with clinical and pathohistological characteristics of patients, higher frequency of genotype GG of
Associations between selected SNPs and clinico-histopathological characteristics of patients
TNM staging | Grade of differentiation | Perineural invasion | Lymphovascular invasion | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene/ SNP ID | Frequency | T1+T2 | T3+T4 | N0 | N1+N2 | 1+2 | 3 | No | Yes | No | Yes | |||
4.76 | 0.0 | 5.9 | 7.3 | 0.0 | 4.8 | 5.3 | 5.2 | 0.0 | 5.8 | 0.0 | ||||
29.25 | 31.0 | 28.8 | 26.0 | 35.3 | 27.8 | 42.1 | 29.9 | 23.1 | 27.3 | 38.5 | ||||
65.99 | 69.0 | 65.3 | 66.7 | 64.7 | 67.5 | 52.6 | 64.9 | 76.9 | 66.9 | 61.5 | ||||
Statistical analysis | 0.346 | 0.096 | 1.000 | 1.000 | 0.354 | p-value | AA vs AG+GG | |||||||
1.261 | 1.573 | 0.900 | 1.102 | 1.228 | OR | |||||||||
1.159–1.373 | 1.388–1.783 | 0.102–7.916 | 1.045–1.162 | 1.135–1.329 | 95% CI | |||||||||
0.828 | 1.000 | 0.303 | 0.543 | 0.656 | p-value | AA+AG vs GG | ||||||||
0.814 | 0.960 | 0.556 | 1.860 | 0.820 | OR | |||||||||
0.340–1.948 | 0.471–1.958 | 0.210–1.471 | 0.488–7.089 | 0.342–1.967 | 95% CI | |||||||||
5.84 | 12.0 | 4.5 | 7.8 | 2.1 | 5.2 | 5.3 | 5.6 | 7.7 | 7.1 | 0.0 | ||||
36.50 | 52.0 | 33.0 | 37.8 | 34.0 | 37.9 | 26.3 | 38.7 | 15.4 | 35.4 | 41.7 | ||||
57.66 | 36.0 | 62.5 | 54.4 | 63.8 | 56.9 | 68.4 | 55.6 | 76.9 | 57.5 | 58.3 | ||||
Statistical analysis | 0.363 | 1.000 | 0.560 | 0.350 | p-value | GG vs GT+TT | ||||||||
2.963 | 1.477 | 0.982 | 0.718 | 1.229 | OR | |||||||||
1.202–7.301 | 0.715–3.050 | 0.112–8.641 | 0.081–6.338 | 1.131–1.334 | 95% CI | |||||||||
0.263 | 0.160 | 0.453 | 0.237 | 1.000 | p-value | GG+GT vs TT | ||||||||
3.880 | 2.918 | 1.641 | 2.657 | 1.034 | OR | |||||||||
0.463–32.516 | 0.649–13.119 | 0.583–4.620 | 0.697–10.127 | 0.523–2.525 | 95% CI | |||||||||
27.27 | 28.6 | 27.0 | 28.1 | 25.5 | 27.9 | 26.3 | 26.7 | 33.3 | 27.7 | 25.0 | ||||
47.55 | 64.3 | 43.5 | 52.1 | 38.3 | 47.5 | 52.6 | 48.9 | 33.3 | 51.3 | 29.2 | ||||
25.17 | 7.1 | 29.6 | 19.8 | 36.2 | 24.6 | 21.1 | 24.4 | 33.3 | 21.0 | 45.8 | ||||
Statistical analysis | 1.000 | 0.843 | 1.000 | 0.736 | 1.000 | p-value | AA vs AG+GG | |||||||
1.084 | 1.141 | 1.082 | 0.729 | 1.151 | OR | |||||||||
0.433–2.713 | 0.517–2.521 | 0.362–3.234 | 0.207–2.573 | 0.420–3.152 | 95% CI | |||||||||
1.000 | 0.497 | p-value | AA+AG vs GG | |||||||||||
5.457 | 2.296 | 0.818 | 1.547 | 3.182 | OR | |||||||||
1.226–24.284 | 1.054–5.002 | 0.252–2.654 | 0.437–5.479 | 1.273–7.952 | 95% CI | |||||||||
51.59 | 46.7 | 52.8 | 48.6 | 58.0 | 50.4 | 55.0 | 50.7 | 61.5 | 51.9 | 50.0 | ||||
38.22 | 33.3 | 39.4 | 41.1 | 32.0 | 39.3 | 35.0 | 39.6 | 23.1 | 38.2 | 38.5 | ||||
10.19 | 20.0 | 7.9 | 10.3 | 10.0 | 10.4 | 10.0 | 9.7 | 15.4 | 9.9 | 11.5 | ||||
Statistical analysis | 0.685 | 0.306 | 0.812 | 0.567 | 1.000 | p-value | AA vs AG+GG | |||||||
0.784 | 0.685 | 0.830 | 0.643 | 1.079 | OR | |||||||||
0.353–1.739 | 0.348–1.348 | 0.323–2.133 | 0.201–2.058 | 0.465–2.504 | 95% CI | |||||||||
0.085 | 1.000 | 1.000 | 0.624 | 0.731 | p-value | AA+AG vs GG | ||||||||
0.342 | 0.970 | 0.960 | 1.688 | 1.184 | OR | |||||||||
0.113–1.030 | 0.318–2.957 | 0.201–4.580 | 0.339–8.399 | 0.312–4.488 | 95% CI |
We have further evaluated the correlation of genotype frequencies in patients with progression compared to patients without disease progression. We found association between tumour TNM staging and SNP rs373572 in gene
The results of survival analysis showed association with SNP rs1990172 in gene
Our study is the first report of the association between SNP rs373572 in
Association between SNP rs373572 in
Association between
In our study we also found association between genotype GG of
We also investigated SNP rs1801157 in
Stage III CRC patients are those who benefit from adjuvant chemotherapy resulting in increased DFS and OS at 6 and 10 years of follow up.38, 39 Patients with stage II disease with negative prognostic factors also benefit from adjuvant chemotherapy. There is however some controversy regarding unselected patients of stage II and also to some extent of stage I, because it is not always objectively possible to make a clear conclusion regarding negative regional lymph node status and the absence of negative pathohistological prognostic factors.40
TNM staging has in proportion of patients low prognostic value. Resection of appropriate number of lymph nodes is frequently impossible. In only about 50% of patients the required resection of 12 lymph nodes is achieved.16, 41, 42 Next to that, light microscopy has its limitations regarding sensitivity regarding detection of malignant cells in regional lymph nodes.43 Also only a proportion of a pathological specimen can be examined and this can lead to false negative reports regarding pathological risk factors.17 Inadequate resection of appropriate number of lymph nodes and limitations of light microscopy may lead to false downward stage migration. Lymphovascular and perineural invasion are negative prognostic factors, but they can also be underreported.44, 45 Considering these facts we see, that a substantial proportion of patients is undertreated.
A proportion of patients can have a more malignant phenotype irrespective of the TNM stage and known pathohistological prognostic factors, predisposing them to a more aggressive course of the disease. An intrinsic molecular characteristic, like nucleotide polymorphism, might prove extremely helpful in this regard. Polymorphisms of genes participating in carcinogenesis and disease dissemination thereby represent a potential new prognostic marker.
We have investigated patients from northeastern part of Slovenia almost exclusively of Slovenian origin. Our results regarding genotype distribution and connection with pathohistological characteristics are most consistent with study conducted by Dziki
There is however also a question of appropriate study design, especially clinical endpoint. OS is of course the most important endpoint in oncology research, but it may be influenced by many treatment related factors beyond the point of disease relapse. DFS is therefore more appropriate clinical endpoint in resectable disease in research of prognostic markers. Although our results indicate the role of polymorphisms, further research is needed to validate our findings.
Screening of polymorphisms in selected genes of CRC patients in our study suggested that they may have a role as a prognostic factors in resectable CRC. In conclusion, the goal is to identify patients who are going to derive most clinical benefit, without facing unnecessary side effects.