Cite

Figure 1

An effect of clinostat rotation on induction of HSP70 and HSP90 genes in Arabidopsis thaliana (Col) seedlings during heat shock. 12-d-old seedlings grown under stationary conditions (control) or clinorotation were exposed at 37°C for the indicated times. Expression levels were assessed using RT-qPCR, and normalized with respect to UBQ5 mRNA. Relative mRNA amounts were calculated as a fold change to the control (= 0 h of the heat treatment). Data are means of three independent biological samples with three analytical replicates ± s.d. The effect of high temperature was significant for all the HSPs; the effect of clinorotation was significant for AtHSP70-2, AtHSP70-3, AtHSP70-4, AtHSP70-5, and AtHSP90-1 (Two-way ANOVA, p < 0.05).
An effect of clinostat rotation on induction of HSP70 and HSP90 genes in Arabidopsis thaliana (Col) seedlings during heat shock. 12-d-old seedlings grown under stationary conditions (control) or clinorotation were exposed at 37°C for the indicated times. Expression levels were assessed using RT-qPCR, and normalized with respect to UBQ5 mRNA. Relative mRNA amounts were calculated as a fold change to the control (= 0 h of the heat treatment). Data are means of three independent biological samples with three analytical replicates ± s.d. The effect of high temperature was significant for all the HSPs; the effect of clinorotation was significant for AtHSP70-2, AtHSP70-3, AtHSP70-4, AtHSP70-5, and AtHSP90-1 (Two-way ANOVA, p < 0.05).

Figure 2

An effect of clinostat rotation on expression of HSP70 and HSP90 genes in Arabidopsis thaliana (Col) seedlings. The bars present the fold change of transcript abundance in 12-d-old seedlings grown under clinorotation relative to the control (seedlings grown under stationary conditions, = 1; dotted line). HSP90 c represents AtHSP90-2, AtHSP90-3, and AtHSP90-4 (in total). Bars denoted with an asterisk (*) indicate differences between the rotated and control seedlings that are statistically significant, compared with the control (Student's t-test, p < 0.05). Expression levels were assessed using RT-qPCR and normalized with respect to UBQ5 mRNA. Data are means of three independent biological samples with three analytical replicates ± s.d.
An effect of clinostat rotation on expression of HSP70 and HSP90 genes in Arabidopsis thaliana (Col) seedlings. The bars present the fold change of transcript abundance in 12-d-old seedlings grown under clinorotation relative to the control (seedlings grown under stationary conditions, = 1; dotted line). HSP90 c represents AtHSP90-2, AtHSP90-3, and AtHSP90-4 (in total). Bars denoted with an asterisk (*) indicate differences between the rotated and control seedlings that are statistically significant, compared with the control (Student's t-test, p < 0.05). Expression levels were assessed using RT-qPCR and normalized with respect to UBQ5 mRNA. Data are means of three independent biological samples with three analytical replicates ± s.d.

Figure 3

An effect of clinostat rotation on heat shock survival of Arabidopsis thaliana (Col) seedlings. 12-d-old seedlings grown under stationary conditions (control) (A, B) or clinorotation (C, D) at 22 ± 1°C were exposed at 45°C for 45 min and recovered under the stationary conditions. (A, C) seedlings before the heat treatment and (B, D) seedlings after a 6-d recovery period (B, D). (E) Survival rate of the seedlings after the heat treatment. Data are means ± s.d. (n = 3 plates with ~25 seedlings each; * Student's t-test, p < 0.05).
An effect of clinostat rotation on heat shock survival of Arabidopsis thaliana (Col) seedlings. 12-d-old seedlings grown under stationary conditions (control) (A, B) or clinorotation (C, D) at 22 ± 1°C were exposed at 45°C for 45 min and recovered under the stationary conditions. (A, C) seedlings before the heat treatment and (B, D) seedlings after a 6-d recovery period (B, D). (E) Survival rate of the seedlings after the heat treatment. Data are means ± s.d. (n = 3 plates with ~25 seedlings each; * Student's t-test, p < 0.05).

Figure 4

An effect of clinostat rotation on heat shock survival of Arabidopsis thaliana (Col) seedlings. (A) 5-d-old seedlings grown in the stationary conditions or under clinostat rotation at 22 ± 1°C were exposed at 45°C for 45 min, and recovered under the stationary conditions for 3 d. (B) Survival rate of the seedlings after the heat treatment. Data are means ± s.d. (n = 3; * Student's t-test, p < 0.05).
An effect of clinostat rotation on heat shock survival of Arabidopsis thaliana (Col) seedlings. (A) 5-d-old seedlings grown in the stationary conditions or under clinostat rotation at 22 ± 1°C were exposed at 45°C for 45 min, and recovered under the stationary conditions for 3 d. (B) Survival rate of the seedlings after the heat treatment. Data are means ± s.d. (n = 3; * Student's t-test, p < 0.05).

Primers of target genes used for RT-qPCR.

Gene nameAGI codePrimer sequences (5’ to 3’)
AtHSP70-1AT5G02500F: AAACCCTAGCCGCCTTATTC
R: GATAGCTGGTCCTTCTCCTTTAC
AtHSP70-2AT5G02490F: AGCTTGTGAGAGAGCAAAGAG
R: ACGGGTGATTGGAGAATAGA
AtHSP70-3AT3G09440F: GACATTAGTGGAAACCCGAGAG
R: GTCTGAGCCGTAGATGACAAAG
AtHSP70-4AT3G12580F: AGGGCACGAACAAAGGACAACAAC
R: TCAGCCGACACATTCAGGATACCA
AtHSP70-5AT1G16030F: GGAGCTATCTCTGGGCTTAATG
R: GGCCTTCGTACCCTTCTTATC
AtHSP90-1AT5G52640F: GTTACCCTATCTACCTTTGGACCG
R: CTGCTTGTTGATGAGTTCCCAC
AtHSP90-2,AT5G56030To detect mRNA of three genes in total:
AtHSP90-3,AT5G56010F: GCTACCCAATCTCTCTCTGGATT
AtHSP90-4AT5G56000R: GTACTCCTCCTTGTTGATCTCCTC
AtUBQ5AT3G62250F: AACCCTTGAGGTTGAATCATCC
R: GTCCTTCTTTCTGGTAAACGT
eISSN:
2332-7774
Idioma:
Inglés
Calendario de la edición:
2 veces al año
Temas de la revista:
Life Sciences, other, Materials Sciences, Physics