<abstract xmlns="http://www.w3.org/1999/xhtml">

<sec id="j_jvetres-2019-0049_s_005">
<h3>Introduction</h3>
<p>Carbapenem-resistant <italic>Pseudomonas aeruginosa</italic> (CRPA) has become the leading cause of health care-associated infections. Treatment is difficult due to the lack of an effective antimicrobial therapy, and mortality is high. This study investigated the occurrence of CRPA in farm animals (buffaloes and cattle), livestock drinking water, and humans in Egypt.</p></sec>
<sec id="j_jvetres-2019-0049_s_006">
<h3>Material and Methods</h3>
<p>A total of 180 samples were examined: 50 faecal each from buffaloes and cattle, 30 of livestock drinking water, and 50 stool from humans. The samples were cultured on cetrimide agar and the plates were incubated aerobically at 37°C for 24 h. The isolates were examined for the presence of the <italic>bla<sub>KPC</sub></italic>, <italic>bla<sub>OXA-48</sub></italic>, and <italic>bla<sub>NDM</sub></italic> carbapenemase-encoding genes using PCR and investigated for the exotoxin A (<italic>toxA</italic>) gene. The <italic>toxA</italic> gene from carbapenem- group resistant isolates was phylogenetically analysed.</p></sec>
<sec id="j_jvetres-2019-0049_s_007">
<h3>Results</h3>
<p><italic>P. aeruginosa</italic> was isolated from buffaloes, cattle, drinking water, and humans, with occurrences of 40%, 34%, 10%, and 20%, respectively. Carbapenem resistance genes were found in 60%, 59%, 67%, and 70% in buffalo, cattle, water and human samples, respectively. The <italic>toxA</italic> gene was detected in 80% of samples. The phylogenetic analysis showed that cattle and water sequences were in one cluster and more related to each other than to human isolates.</p></sec>
<sec id="j_jvetres-2019-0049_s_008">
<h3>Conclusion</h3>
<p>Occurrence of CRPA among farm animals, drinking water, and humans was high, reflecting the environmental origin of <italic>P. aeruginosa</italic> and highlighting contaminated water as a potential transmitter of CRPA to livestock and next to humans.</p></sec>
</abstract>

Introduction
Carbapenem-resistant Pseudomonas aeruginosa (CRPA) has become the leading cause of health care-associated infections. Treatment is difficult due to the lack of an effective antimicrobial therapy, and mortality is high. This study investigated the occurrence of CRPA in farm animals (buffaloes and cattle), livestock drinking water, and humans in Egypt.

Material and Methods
A total of 180 samples were examined: 50 faecal each from buffaloes and cattle, 30 of livestock drinking water, and 50 stool from humans. The samples were cultured on cetrimide agar and the plates were incubated aerobically at 37°C for 24 h. The isolates were examined for the presence of the blaKPC, blaOXA-48, and blaNDM carbapenemase-encoding genes using PCR and investigated for the exotoxin A (toxA) gene. The toxA gene from carbapenem- group resistant isolates was phylogenetically analysed.

Results
P. aeruginosa was isolated from buffaloes, cattle, drinking water, and humans, with occurrences of 40%, 34%, 10%, and 20%, respectively. Carbapenem resistance genes were found in 60%, 59%, 67%, and 70% in buffalo, cattle, water and human samples, respectively. The toxA gene was detected in 80% of samples. The phylogenetic analysis showed that cattle and water sequences were in one cluster and more related to each other than to human isolates.

Conclusion
Occurrence of CRPA among farm animals, drinking water, and humans was high, reflecting the environmental origin of P. aeruginosa and highlighting contaminated water as a potential transmitter of CRPA to livestock and next to humans.

Carbapenem-resistant <italic>Pseudomonas aeruginosa</italic> originating from farm animals and people in Egypt

Journal of Veterinary Research

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Carbapenem-resistant  originating from farm animals and people in Egypt

Introduction
Carbapenem-resistant Pseudomonas aeruginosa (CRPA) has become the leading cause of health care-associated infections. Treatment is difficult due...

Gene	Sequence (5'–3')	Size (bp)	References
bla_KPC	F: ATGTCACTGTATCGCCGTCT	882
	R: TTTTCAGAGCCT TACTGCCC
bla_OXA-48	F: TTGGTGGCATCGATTATCGG	743
	R: GAGCACTTCTTTTGTGATGGC		Hamza et al (9).
bla_NDM	F: GGTTTGGCGATCTGGTTTTC	621
	R: CGGAATGGCTCATCACGATC
toxA	F: GACAACGCCCTCAGCATCACCAGC	396
	R: CGCTGGCCCATTCGCTCCAGCGCT		Xu et al (28).

Carbapenem-resistant Pseudomonas aeruginosa originating from farm animals and people in Egypt

Published Online: Sep 13, 2019

Page range: 333 - 337

Received: Feb 07, 2019

Accepted: Jul 24, 2019

DOI: https://doi.org/10.2478/jvetres-2019-0049

Keywords
farm animals, humans, water, antibiotic-resistant, carbapenem, Egypt

© 2019 E.A. Elshafiee et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Occurrence among different sources of P. aeruginosa, carbapenem-resistant P. aeruginosa (CRPA), and exotoxin A in the tested samples

List of primers used in this study

Origin of sample	Number of samples	Number of samples positive for P. aeruginosa	Occurrence of P. aeruginosa (%)	Number of samples positive for CRPA	Occurrence of CRPA (%)	Exotoxin A
Buffalo	50	20	40	12	60	40 strains out of 50 (80%)
Cattle	50	17	34	10	59
Livestock drinking water	30	3	10	2	67
Human	50	10	20	7	70

Carbapenem-resistant Pseudomonas aeruginosa originating from farm animals and people in Egypt

Published Online: Sep 13, 2019

Page range: 333 - 337

Received: Feb 07, 2019

Accepted: Jul 24, 2019

DOI: https://doi.org/10.2478/jvetres-2019-0049

Keywordsfarm animals, humans, water, antibiotic-resistant, carbapenem, Egypt

© 2019 E.A. Elshafiee et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Fig. 1

Occurrence among different sources of P. aeruginosa, carbapenem-resistant P. aeruginosa (CRPA), and exotoxin A in the tested samples

List of primers used in this study

Keywords
farm animals, humans, water, antibiotic-resistant, carbapenem, Egypt