<abstract xmlns="http://www.w3.org/1999/xhtml">

<sec id="j_jvetres-2019-0042_s_005">
<h3>Introduction</h3>
<p>The characteristics of immune factors in somatic cells from lactating dairy cows and their association with commensal bacteria in normal milk have not been clarified. This study investigated the relationship between the pathogenic bacteria in milk and somatic cell immune factors in healthy lactating cows.</p></sec>
<sec id="j_jvetres-2019-0042_s_006">
<h3>Material and Methods</h3>
<p>In total 44 healthy Holstein cows were studied on one farm. Milk samples were collected aseptically using a cannula and these samples were cultured for detection of bacteria and analysis of mRNA of immune factors expressed by somatic cells. Cows were divided into two groups based on the microbial status of their milk samples: 12 cows showed bacteria in cultures (positive group), and the other 32 cows did not (negative group).</p></sec>
<sec id="j_jvetres-2019-0042_s_007">
<h3>Results</h3>
<p>The mRNA levels of IL-6, lactotransferrin, and cathelicidin expressed by somatic cells after milking decreased significantly compared to those before milking in both groups (P &lt; 0.05). There were significantly lower mRNA levels of IL-6 and cathelicidin in the positive group compared to those in the negative group before milking.</p></sec>
<sec id="j_jvetres-2019-0042_s_008">
<h3>Conclusion</h3>
<p>These results suggest that mRNA levels of IL-6 and cathelicidin expressed by the somatic cells may be affected by the presence of bacteria in healthy lactating dairy cows.</p></sec>
</abstract>

Introduction
The characteristics of immune factors in somatic cells from lactating dairy cows and their association with commensal bacteria in normal milk have not been clarified. This study investigated the relationship between the pathogenic bacteria in milk and somatic cell immune factors in healthy lactating cows.

Material and Methods
In total 44 healthy Holstein cows were studied on one farm. Milk samples were collected aseptically using a cannula and these samples were cultured for detection of bacteria and analysis of mRNA of immune factors expressed by somatic cells. Cows were divided into two groups based on the microbial status of their milk samples: 12 cows showed bacteria in cultures (positive group), and the other 32 cows did not (negative group).

Results
The mRNA levels of IL-6, lactotransferrin, and cathelicidin expressed by somatic cells after milking decreased significantly compared to those before milking in both groups (P < 0.05). There were significantly lower mRNA levels of IL-6 and cathelicidin in the positive group compared to those in the negative group before milking.

Conclusion
These results suggest that mRNA levels of IL-6 and cathelicidin expressed by the somatic cells may be affected by the presence of bacteria in healthy lactating dairy cows.

Relationship between mRNA of immune factors expressed by milk somatic cells and bacteria present in healthy lactating Holstein cows

Journal of Veterinary Research

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Introduction
The characteristics of immune factors in somatic cells from lactating dairy cows and their association with commensal bacteria in normal milk have...

		Positive group	Negative group
interleukin-6	before	11.80 ± 1.17^a	16.33 ± 0.68^a	*
	after	7.97 ± 1.12^b	11.98 ± 0.71^b	*
lysozyme	before	5.27 ± 0.34	5.39 ± 0.18
	after	5.13 ± 0.25	5.31 ± 0.25
lactotransferrin	before	9.28 ± 1.74^a	11.32 ± 0.75^a
	after	7.60 ± 0.97^b	8.42 ± 0.61^b
defensin-β3	before	3.86 ± 0.27	2.99 ± 0.21
	after	3.60 ± 0.37	3.78 ± 0.18
cathelicidin	before	6.27 ± 0.56^a	8.24 ± 0.42^a	*
	after	4.61 ± 0.74^b	5.86 ± 0.39^b
pentraxin-3	before	4.31 ± 0.24	4.97 ± 0.22
	after	3.84 ± 0.35	4.20 ± 0.20
caspase-3	before	13.84 ± 1.23	15.22 ± 0.30^a
	after	12.86 ± 0.92	13.49 ± 0.66^b
elastase	before	10.07 ± 0.96	11.19 ± 0.33
	after	10.043 ± 0.45	10.71 ± 0.25

Gene	Accession number	Product length	Primer designation	Sequence (5'-3')
β-actin	NM_173979.3	76	Forward	CCCAGATCATGTTCGAGACC
			Reverse	GAGGCATACAGGGACAGCAC
interleukin-6	NM_173923.2	102	Forward	AGATCCTGAAGCAAAAGATCGC
			Reverse	TTGCGTTCTTTACCCACTCGT
lysozyme	NM_001078159.1	104	Forward	TTCGGTCGCTGTCCAAGGCAAGGT
			Reverse	TCCAGTTTGCCAGGCTGATTCCCC
			Forward	CACCGAGCACTGGATAAAGGG
lactotransferrin	NM_180998.2	136	Reverse	AGCCAGACACAGTCCAAGGG
			Forward	GCATACAAGTGACTGCCCCTG
defensin-β3	NM_001282581.1	70	Reverse	ACTGAACCTCTTCCCTGTGTG
cathelicidin	Y09472.1	70	Forward	GAAAGACTCTCCTACCCTGCCC
			Reverse	CTCTAAGGGACACACAGCCAGG
pentraxin-3	NM_001076259.2	80	Forward	GCAGAGTCCTGTCACATCCG
			Reverse	ACATACTGTGCTCCTCCGTG
caspase-3	NM_001077840.1	148	Forward	CAGGAGTGGAGTCCAGCAGA
			Reverse	TCCAGAGTCCATTGATTTGCTTC
elastase	NM_001105653.1	119	Forward	TTGCCTCTGTCGCCAAGTTT
			Reverse	ACAGCCTTTCTAGTGGGTCC

	aerobic culture		anaerobic culture
	before	after	before	after
Aerococcus viridans	3	1	2	1
Staphylococcus chromogenes	1	1	1	1
Staphylococcus haemolyticus	3	2	2	1
Staphylococcus xylosus	3	3	4	4
Streptococcus dysgalactiae	0	1	1	1

Relationship between mRNA of immune factors expressed by milk somatic cells and bacteria present in healthy lactating Holstein cows

Article Category: Short Communication

Published Online: Sep 13, 2019

Page range: 369 - 373

Received: Jan 09, 2019

Accepted: Jul 02, 2019

DOI: https://doi.org/10.2478/jvetres-2019-0042

Keywords
cows, milk, bacteria, immune factor, somatic cells

© 2019 H. Ohtsuka et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Relative mRNA level of immune factors expressed by milk cells compared to β-actin expression

Primers used for real-time PCR

Major bacteria detected before and after milking in the positive group (n = 12)

Relationship between mRNA of immune factors expressed by milk somatic cells and bacteria present in healthy lactating Holstein cows

Article Category: Short Communication

Published Online: Sep 13, 2019

Page range: 369 - 373

Received: Jan 09, 2019

Accepted: Jul 02, 2019

DOI: https://doi.org/10.2478/jvetres-2019-0042

Keywordscows, milk, bacteria, immune factor, somatic cells

© 2019 H. Ohtsuka et al. published by Sciendo

This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 3.0 License.

Relative mRNA level of immune factors expressed by milk cells compared to β-actin expression

Primers used for real-time PCR

Major bacteria detected before and after milking in the positive group (n = 12)

Keywords
cows, milk, bacteria, immune factor, somatic cells