Open Access

Expression of LOC285758, a potential long non-coding biomarker, is methylation-dependent and correlates with glioma malignancy grade

Alenka Matjasic
Alenka Matjasic
, 
Mara Popovic
Mara Popovic
, 
Bostjan Matos
Bostjan Matos
 and 
Damjan Glavac
Damjan Glavac
   | Jan 14, 2017
Radiology and Oncology's Cover Image
About this article
Previous Article
Next Article
Cite
Article Category: Research Article
Published Online: Jan 14, 2017
Page range: 331 - 341
Received: Oct 24, 2016
Accepted: Nov 22, 2016
DOI: https://doi.org/10.1515/raon-2017-0004
© 2017 Alenka Matjasic, Mara Popovic, Bostjan Matos and Damjan Glavac
This work is licensed under the Creative Commons Attribution 4.0 International License.

Figure 1

Venn’s diagram of lncRNAs that were significantly differentially expressed using microarray screening of lncRNAs involved in epigenetic mechanisms and/or pathways. (A) Number of lncRNAs in regard to the number of subtypes in which they were found differentially expressed (the number of subtypes rises from the outer circle (one subtype) towards the inner one (four subtypes)). (B) The number of lncRNAs found differentially expressed in all four analysed subtypes (using two levels of stringency – absolute fold change cut-off value of 1.5 and (2)).
Venn’s diagram of lncRNAs that were significantly differentially expressed using microarray screening of lncRNAs involved in epigenetic mechanisms and/or pathways. (A) Number of lncRNAs in regard to the number of subtypes in which they were found differentially expressed (the number of subtypes rises from the outer circle (one subtype) towards the inner one (four subtypes)). (B) The number of lncRNAs found differentially expressed in all four analysed subtypes (using two levels of stringency – absolute fold change cut-off value of 1.5 and (2)).

Figure 2

(A) Differential expression of LOC285758 in individual samples (y-axis presents ΔΔCT values). (B) Comparison of average ΔΔCT values for individual glioma subtype, determined by microarray and qPCR. Oligoastrocytoma samples were not included in microarray analysis. ΔΔCT represents difference of gene’s expression in comparison to brain reference RNA, and the positive values mean that gene’s levels are increased. p-values were determined for qPCR data (ANOVA for comparing all five subtypes and Mann-Whitney U-test for comparing two subtypes).
(A) Differential expression of LOC285758 in individual samples (y-axis presents ΔΔCT values). (B) Comparison of average ΔΔCT values for individual glioma subtype, determined by microarray and qPCR. Oligoastrocytoma samples were not included in microarray analysis. ΔΔCT represents difference of gene’s expression in comparison to brain reference RNA, and the positive values mean that gene’s levels are increased. p-values were determined for qPCR data (ANOVA for comparing all five subtypes and Mann-Whitney U-test for comparing two subtypes).

Figure 3

Scatter plots showing (A)LOC285758 expression (qPCR) in association to methylation status. Unmethylated samples showed higher expression levels compared to methylated ones. (B)LOC285758 expression and promoter methylation status significantly differ regarding the WHO malignancy grade and (C) glioma subtype, especially comparing astrocytoma grade I-III (all samples were methylated) to grade IV (GBMs were largely unmethylated).Promoter methylation: 0 = unmethylated, 1 = methylated
Scatter plots showing (A)LOC285758 expression (qPCR) in association to methylation status. Unmethylated samples showed higher expression levels compared to methylated ones. (B)LOC285758 expression and promoter methylation status significantly differ regarding the WHO malignancy grade and (C) glioma subtype, especially comparing astrocytoma grade I-III (all samples were methylated) to grade IV (GBMs were largely unmethylated).Promoter methylation: 0 = unmethylated, 1 = methylated

Association of LOC285758 expression with patients demographic data and glioma hallmark biomarkers: mutations of IDH1 and TP53, copy number variations of CDKN2A and CDKN2B, and loss of chromosome arm 1p and 19q (1p/19q co-deletion)

LOC285758 expression LOC285758 promoter methylation
rs p-value rs p-value
Gender -0.044 0.634 0.009 0.920
Age at diagnosis (< 45y >) 0.065 0.475 -0.313 < 0.001
WHO grade (low/high) 0.213 0.019 -0.433 < 0.001
IDH1 (wt/mut) 0.375 < 0.001 0.096 0.331
TP53(wt/mut) -0.083 0.483 0.153 0.178
1p loss (wt/del) 0.310 0.005 -0.396 < 0.001
19q loss (wt/del) 0.267 0.032 -0.360 0.002
1p/19q loss (wt/del) 0.262 0.014 -0.373 < 0.001
CDKN2A (wt/del) 0.085 0.477 -0.231 0.042
CDKN2B (wt/del) 0.093 0.435 -0.240 0.033

Patients’ demographics and glioma histopathological classification

Patients demographic
Number of patients 157
Gender (female/male) 67/90 (1 : 1.34)
Mean age at diagnosis (years) 43.8 (SD ±18,89)
# < 45 years 86
# > 45 years 71
Glioma classification Glioma subtype WHO grade
Astrocytoma (AC) 15 pilocytic WHO I
9 diffuse WHO II
11 diffuse with signs of anaplasia WHO II-III
9 anaplastic WHO III
23 secondary GBM WHO IV
31 primary GBM WHO IV
Oligodendroglioma (ODG) 4 diffuse WHO II
5 diffuse with signs of anaplasia WHO II-III
28 anaplastic WHO III
Oligoastrocytoma (OAC) 2 diffuse WHO II
3 diffuse with signs of anaplasia WHO II-III
17 anaplastic WHO III

Primers used for validation of LOC285758 expression profiling results, reference genes and determining methylation status of lncRNA’s promoter

Quantitative real-time PCR
Gene Assay ID Amplicon length (bp) Annealing temperature (°C)
LOC285758 Hs.PT.58.26012748 129 60
GAPDH QT00079247 95 55
Gene Primer sequence (5’ - 3’) Amplicon length (bp) Annealing temperature (°C)
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT 94 60
Methylation sensitive HRM
Gene Oligonucleotide sequence (5’ – 3’) Amplicon length (bp) Annealing temperature (°C)
LOC285758 F TTGTTTTTTGAAAGTTTTTTGA 118 55
LOC285758 R AAACACAAAAAACCTAACAAAAA

Top 10 lncRNAs that showed significantly increased/decreased expression in four glioma subtypes, using the LncPath Human Epigenetic Pathway microarray (ArrayStar, USA)

Astrocytoma II+III

II+III – tumours of WHO grade II and III; (abs) = absolute value; FC = fold change

 Secondary GBM Primary GBM Oligodendroglioma
FC(abs) Gene Name FC(abs) Gene Name FC(abs) Gene Name FC(abs) Gene Name
TOP 10 OVER-EXPRESSED
9.775 RP11-434O22.1 9.840 APOC2 11.343 AK024556 10.085 RP6-201G10.2
7.863 LOC285758 9.105 AK024556 9.761 FJ209302 7.233 LOC285758
6.203 LOC100129034 7.971 LOC100129034 9.402 AK055628 6.241 GAS5
5.247 RP11-264F23.3 7.578 AK055628 9.267 H19 5.454 RP11-264F23.3
5.211 RP6-201G10.2 4.509 RP11-145M9.3 7.012 RP11-434O22.1 5.360 LOC100216546
5.107 APOC2 4.243 RP11-73E17.2 6.720 APOC2 5.043 SNRPE
4.374 RP11-770J1.3 3.657 KB-1836B5.1 5.527 LOC285758 4.991 AK024556
4.211 HOXA11-AS 3.394 H19 4.851 LOC100216546 4.930 AC009506.1
3.861 RP3-405J24.1 2.878 BANCR 4.770 LOC100129034 4.351 RP11-73E17.2
3.795 AK055628 2.695 AB447886 4.525 HOXA11-AS 3.846 LOC286059
TOP 10 UNDER-EXPRESSED
9.638 RP11-678P16.1 24.555 MEG3 22.494 MEG3 43.328 RP11-678P16.1
7.026 XLOC_013368 11.341 AK054921 16.532 AK054921 23.879 FABP5P3
6.797 AK054921 8.050 AF520792 11.157 RP11-678P16.1 18.840 DGCR5
6.148 MEG3 6.845 DGCR5 8.208 DGCR5 8.073 MEG3
6.003 RP11-18F14.2 6.623 XLOC_013368 8.207 XLOC_013368 7.092 AK054921
5.820 HAR1A 6.470 AK054970 7.979 HAR1B 6.887 XLOC_013368
5.052 SNAR-A2 6.243 HAR1A 6.325 HAR1A 6.318 NEAT1
4.216 FABP5P3 6.114 XIST 6.218 SNAR-A2 6.205 SEPT7P6
4.082 RP11-325F22.4 5.799 MIAT 6.066 RP11-208G20.2 6.090 CASC2
3.887 SEPT7P6 5.712 SNAR-A2 5.652 XLOC_008014 5.873 TMSB10P2
eISSN:
1581-3207
Language:
English
Publication timeframe:
4 times per year
Journal Subjects:
Medicine, Clinical Medicine, Internal Medicine, Haematology, Oncology, Radiology
Journal RSS Feed