Open Access

IRAK inhibitor can improve insulin sensitivity in insulin-resistant mice fed with a high-fat diet

Mostafa Allahyari
Mostafa Allahyari
, 
Athena Rajaie
Athena Rajaie
 and 
Hossein Fallah
Hossein Fallah
   | Dec 31, 2020
Asian Biomedicine's Cover Image
About this article
Previous Article
Next Article
Cite
Article Category: Original article
Published Online: Dec 31, 2020
Page range: 253 - 260
DOI: https://doi.org/10.1515/abm-2020-0034
Keywords
© 2020 Mostafa Allahyari et al., published by Sciendo
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License.

Figure 1

Timeline of treatment of the mice. Mice were treated with their respective diets for 14 weeks. They were treated with the interventional drugs or controls for the final 2 weeks ahead of final measurements.
Timeline of treatment of the mice. Mice were treated with their respective diets for 14 weeks. They were treated with the interventional drugs or controls for the final 2 weeks ahead of final measurements.

Figure 2

(A) Weight of the mice at the beginning (light gray) and the end (dark gray) of the study. The mice were treated for 2 weeks with IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Control mice received no treatment. (B) Weight gain (n = 8 mice in each group). ***P < 0.0001 compared with the control group (high-fat diet). ###P < 0.0001 compared with the sham group (high-fat diet, DMSO vehicle control treatment). *P < 0.05 compared with the standard diet group.
(A) Weight of the mice at the beginning (light gray) and the end (dark gray) of the study. The mice were treated for 2 weeks with IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Control mice received no treatment. (B) Weight gain (n = 8 mice in each group). ***P < 0.0001 compared with the control group (high-fat diet). ###P < 0.0001 compared with the sham group (high-fat diet, DMSO vehicle control treatment). *P < 0.05 compared with the standard diet group.

Figure 3

Serum levels of biochemical factors. Insulin resistance was developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Glucose, triglyceride, and cholesterol were measured in serum of mice after 12 h fasting. **P < 0.001, ***P < 0.0001 compared with the control group. ##P < 0.001, ###P < 0.0001 compared with the sham group, ††P < 0.001 compared with the standard diet group (n = 8 mice per group).
Serum levels of biochemical factors. Insulin resistance was developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Glucose, triglyceride, and cholesterol were measured in serum of mice after 12 h fasting. **P < 0.001, ***P < 0.0001 compared with the control group. ##P < 0.001, ###P < 0.0001 compared with the sham group, ††P < 0.001 compared with the standard diet group (n = 8 mice per group).

Figure 4

Serum levels of insulin in fasting mice. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Blood serum insulin was then measured after 12 h fasting. **P < 0.001 compared with the control group, ##P < 0.001 compared with the sham group (n = 8 mice per group).
Serum levels of insulin in fasting mice. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). Blood serum insulin was then measured after 12 h fasting. **P < 0.001 compared with the control group, ##P < 0.001 compared with the sham group (n = 8 mice per group).

Figure 5

HOMA-IR index in mice after various treatments. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). HOMA-IR was computed using a standard formula. ***P < 0.0001 compared with the control group. ###P < 0.0001 compared with the sham group. †P < 0.05 compared with the standard diet group (n = 8 mice per group).
HOMA-IR index in mice after various treatments. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). HOMA-IR was computed using a standard formula. ***P < 0.0001 compared with the control group. ###P < 0.0001 compared with the sham group. †P < 0.05 compared with the standard diet group (n = 8 mice per group).

Figure 6

IL-6 mRNA copy numbers in mice after various treatments. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). qPCR assayed the level of IL-6 gene expression. *P < 0.05, **P < 0.01, ***P < 0.0001 compared with the control group. #P < 0.05, ##P < 0.001, ###P < 0.0001 compared with the sham group. ††P < 0.001 compared with the standard diet group. ‡‡P < 0.001 comparing IRAKi and IRAKi/Pio groups (n = 8 mice per group).
IL-6 mRNA copy numbers in mice after various treatments. Insulin resistance developed in mice fed with the high-fat diet for 12 weeks, and then these mice were treated for 2 weeks with the IRAKi, pioglitazone (Pio), or a combination of both (IRAKi+Pio). qPCR assayed the level of IL-6 gene expression. *P < 0.05, **P < 0.01, ***P < 0.0001 compared with the control group. #P < 0.05, ##P < 0.001, ###P < 0.0001 compared with the sham group. ††P < 0.001 compared with the standard diet group. ‡‡P < 0.001 comparing IRAKi and IRAKi/Pio groups (n = 8 mice per group).

Primer sequences for qPCR

DirectionGAPDHIL-6
Forward primer (5′–3′)CCCATCACCATCTTCCAGGAGCCCTCTGGTCTTCTGGAGTACC
Reverse primer (5′–3′)CCAGTGAGCTTCCCGTTCAGCACTCCTTCTGTGACTCCAGC
eISSN:
1875-855X
Language:
English
Publication timeframe:
6 times per year
Journal Subjects:
Medicine, Assistive Professions, Nursing, Basic Medical Science, other, Clinical Medicine
Journal RSS Feed