Hepatitis B virus (HBV) is the most prevalent blood-borne pathogen infecting approximately 250 million people [1], and could potentially establish a chronic infection leading to life-threatening cirrhosis and hepatocellular carcinoma. The virus belongs to a family
The major requirements of the newly developed antenatal HBV screening would be the ability to sort out significantly viremic samples with accuracy, rapidity, feasibility, and cost-effectiveness. Turbidity-based loop-mediated isothermal amplification (LAMP) could potentially serve these specific needs [7]. LAMP utilizes a
The whole genome of HBV, strain ayw (NC_003977) [17] was used as a template for primer design (Primer Explorer 4.0, Eiken Chemical CO., LTD., Japan). Three sets of LAMP primers (S1, S2, and X) (
Oligonucleotide sequences of three newly designed and one previously reported primer sets
Primer set | Primer name | Location | Primer sequence (5‘ à 3‘) | Genetic region |
---|---|---|---|---|
S1 | S1_F3 | 470–491 | CCGTTTGTCCTCTAATTCCAGG | |
S1_B3 | 665–688 | GCACTAGTAAACTGAGCCAGGAGA | ||
S1_FIP | 541–564 | GGAGGGATACATAGAGGTTCCTTG-TTTT-CCTCAACAACCAGCACGGGA | ||
494–513 | ||||
S1_BIP | 571–592 | TGTACCAAACCTTCGGACGGAA-TTTT-CCCACTCCCATAGGAATTTTCC | ||
631–652 | ||||
S1_LF | 520–540 | AGCAGTAGTCATGCAGGTCCG | ||
S1_LB | 595–616 | TGCACCTGTATTCCCATCCCAT | ||
S2 | S2_F3 | 659–678 | CTGCATGACTACTGCTCAAGGA | |
S2_B3 | 712–731 | AGCCAAACAGTGGGGGAAAG | ||
S2_FIP | 595–615 | TGGGATGGGAATACAGGTGCA-TTTT-CCTCTATGTATCCCTCCTGTTGCT | ||
548–571 | ||||
S2_BIP | 631–651 | GGAAAATTCCTATGGGAGTGGG-TTTT-CCCTACGAACCACTGAACAAATGG | ||
688–711 | ||||
S2_LF | 572–591 | TCCGTCCGAAGGTTTGGTAC | ||
S2_LB | 659–678 | CCCGTTTCTCCTGGCTCAGT | ||
X | X_F3 | 1493–1512 | CCTTCTCCGTCTGCCGTTCC | X gene |
X_B3 | 1728–1747 | CCCCAACTCCTCCCAGTCTT | ||
X_FIP | 1577–1596 | GTGAAGCGAAGTGCACACGG-TTTT-CACCTCTCTTTACGCGGACTCC | ||
1529–1540 | ||||
X_BIP | 1627–1646 | CGCCCACCAAATATTGCCAA-TTTT-TATGCCTCAAGGTCGGTCGTTG | ||
1686–1707 | ||||
X_LF | 1559–1576 | TCCGGCAGATGAGAAGGC | ||
X_LB | 1662–1685 | GGACTCTTGGACTCTCAGCAATGT | ||
Nyan et al. [19] | Ref_F3 | 530–249 | TCCTCACAATACCGCAGAGT | |
Ref_B3 | 402–421 | GCAGCAGGATGAAGAGGAAT | ||
Ref_FIP | 305–326 | GTTGGGGACTGCGAATTTTGGC-TTTT-TAGACTCGTGGTGGACTTCT | ||
251–270 | ||||
Ref_BIP | 333–354 | TCACTCACCAACCTCCTGTCCT-TTTT-AAAACGCCGCAGACACAT | ||
379–396 | ||||
Ref_LF | 271–294 | GGTGATCCCCCTAGAAAATTGAG | ||
Ref_LB | 357–378 | AATTTGTCCTGGTTATCGCTGG |
F3, outer forward primer; B3, outer backward primer; FIP, forward inner primer; BIP, backward inner primer; LF, loop forward primer; LB, loop backward primer.
The plasmid pUC19 containing a whole HBV genome AB246345 [18] was propagated in MAX Efficiency® DH5α™ competent cells (Thermo Fisher Scientific, USA). The plasmid was extracted and purified using a High-Speed Plasmid Mini Kit (Geneaid Biotech Ltd., Taiwan) and the concentration was measured using a NanoDrop 1000 (Thermo Scientific, USA). The plasmid was adjusted to the concentration of 1 mg/mL and stored as aliquots at −20°C until use.
A HBV LAMP reaction consisted of 2.5 mL of 10× isothermal amplification buffer (New England Biolabs, USA), 150 mM MgSO4, 0.14 mM dNTPs, 5 mM of F3 and B3 primers, 40 mM of forward inner primer (FIP) and backward inner primer (BIP) primers, 10 mM of loop forward primer (LF) and loop backward primer (LB) primers, eight units of
Assay sensitivity was tested from serially diluted standard HBV DNA to the final concentrations of 107, 106, 105, 104, 103, 102, and 10 copies and performed under optimized condition as described above. The reactions were incubated in turbidimeter at 60°C for 60 min and correlation between turbidity detection and HBV genome concentration was analyzed. In the spiked serum experiment, the standard HBV DNA at 108 to 102 copies was spiked into fetal bovine serum (1:100 v/v). Samples were diluted with equal amount of deionized distilled water and incubated at 95°C for 5 min and 100°C for 3 min before proceeding to turbidity-based HBV LAMP. Results were confirmed by four independent experiments.
The specificity of the HBV–LAMP assay was tested under optimized condition with six viral DNAs provided as positive controls as follows: HBV (Abbott, USA), human immunodeficiency virus (HIV) (Abbott, USA), Epstein–Barr virus (EBV, cytomegalovirus (CMV), hepatitis C virus (HCV), and herpes simplex virus (HSV) (Qiagen, Germany). The LAMP products were detected using agarose gel electrophoresis. All standard viral DNAs were kindly gifted from King Chulalongkorn Memorial Hospital and were added at 2 × 105 copies to the reaction.
All plasma samples and their automated qPCR results (Abbott, USA) were courtesy of Virology unit, King Chulalongkorn Memorial Hospital with IRB approval (certificate of approval no. 972/2016) from Ethical Review Board, Faculty of Medicine, Chulalongkorn University. The samples were leftovers from routine diagnosis and stored at −70°C. The frozen plasma was rapidly thawed at 37°C and the DNA was extracted from the samples using the heat treatment method [19]. Briefly, the sample was diluted with equal amount of deionized distilled water, followed by incubation at 95°C for 5 min and 100°C for 3 min. DNA was collected from supernatant after centrifugation at 12,000 g for 5 min. Turbidity-based HBV LAMP assay was performed and analyzed as previously indicated. The LAMP product was also analyzed by gel electrophoresis to confirm the end-point results. Results from turbidimeter and gel electrophoresis were compared with those of qPCR diagnostic records.
Three sets of primers (S1, S2, and X) were generated according to the parameters described in Materials and methods section. Efficacy of primer sets was verified using the standard HBV DNA (
Sensitivity of turbidity- and gel electrophoresis-based HBV LAMP detection system
HBV DNA (copies/ reaction) | Percent detection (No. of times detected/total replicated) | |
---|---|---|
Turbidity based | Gel electrophoresis based | |
2000 | 100 (6/6) | 100 (3/3) |
1000 | 100 (6/6) | 100 (3/3) |
200 | 83 (5/6) | 100 (3/3) |
150 | 83 (5/6) | 100 (3/3) |
50 | 50 (3/6) | 67 (2/3) |
20 | 67 (4/6) | 67 (2/3) |
10 | 33 (1/3) | – |
5 | 33 (1/3) | – |
2.5 | 67 (2/3) | – |
1 | 33 (1/3) | – |
0.5 | 0 (0/3) | – |
0.1 | 33 (1/3) | – |
HBV, hepatitis B virus; LAMP, loop-mediated isothermal amplification.
The turbidity-based LAMP was set up using the optimal condition for S2 primer set as described and the turbidity was detected using hot plate-coupled, real-time turbidimeter [7]. This turbidimeter detected magnesium pyrophosphate by-product from the LAMP assay in real time. We compared sensitivity of both detection systems using serially diluted standard HBV DNA (
Next, we tested the assay performance under the condition mimicking the actual serum samples in order to verify whether sera-derived proteins would interfere with the turbidity readout. Briefly, standard HBV DNA was serially diluted and spiked into fetal bovine serum (1:100 v/v), diluted 1:1 with deionized distilled water and heat treated before proceeding to turbidity-based HBV LAMP. The objective was to study possible turbidity interference from other contents in the serum when processing samples with heat treatment method. Our results were in accordance with the previous report comparing the heat treatment and standard DNA extraction methods [16]. LoD of this experiment was read at 102 copies/reaction with no significant difference from that of the sensitivity test previously described (
The HBV LAMP was tested with the standard DNA of HBV, HIV, HCV, CMV, EBV, and Herpes viruses standardized to 2 × 105 copies/reaction as described in Materials and methods section. The assay was performed in turbidimeter for 60 min and the products were analyzed by gel electrophoresis. Positive results, or a ladder-like pattern, were found only in the HBV sample (
A total of 270 clinical samples consisted of 162 significant (<2 × 105 IU/mL) and 108 nonsignificant (<2 × 105 IU/mL) viremia according to the automated qPCR results. Samples were thawed and DNA was extracted using heat treatment method. HBV LAMP was performed in real-time turbidimeter and results were obtained using turbidity measurement (
Performance of turbidity-, and gel electrophoresis-based HBV LAMP assay at the 2 × 105 IU/mL cutoff titer of HBV qPCR results
Methods | Sensitivity (%) | Specificity (%) | Positive predictive value (%) | Negative predictive value (%) | Accuracy (%) |
---|---|---|---|---|---|
Turbidity-based | 90.12 (146/162) | 83.33 (90/108) | 89.02 (146/164) | 84.90 (90/106) | 87.40 (236/270) |
Gel electrophoresis | 95.06 (154/162) | 75.00 (81/108) | 85.08 (154/181) | 91.01 (81/89) | 87.03 (235/270) |
HBV, hepatitis B virus; LAMP, loop-mediated isothermal amplification; qPCR, quantitative PCR.
Performance of turbidity-, and gel electrophoresis-based HBV LAMP assay at other cutoff titers of HBV qPCR results
Cutoff | Sensitivity | Specificity | PPV | NPV | Accuracy | ||||
---|---|---|---|---|---|---|---|---|---|
106 | 131/139 | 94.2% | 74/105 | 70.5% | 131/162 | 80.9% | 74/82 | 90.2% | 84.0% |
5 × 105 | 140/152 | 92.1% | 70/92 | 76.1% | 140/162 | 86.4% | 70/82 | 85.4% | 86.1% |
105 | 146/162 | 90.1% | 66/82 | 80.5% | 146/162 | 90.1% | 66/82 | 80.5% | 86.9% |
5 × 104 | 150/170 | 88.2% | 62/72 | 83.8% | 150/162 | 92.6% | 62/82 | 75.6% | 86.9% |
104 | 156/185 | 84.3% | 53/59 | 89.8% | 156/162 | 96.3% | 53/82 | 64.6% | 85.7% |
103 | 157/202 | 77.7% | 37/42 | 88.1% | 157/162 | 96.9% | 37/82 | 45.1% | 79.5% |
106 | 135/139 | 97.1% | 63/105 | 60.0% | 135/177 | 76.3% | 63/67 | 94.0% | 81.1% |
5 × 105 | 147/152 | 96.7% | 62/92 | 67.4% | 147/177 | 83.1% | 62/67 | 92.5% | 85.7% |
105 | 154/162 | 95.1% | 59/82 | 72.0% | 154/177 | 87.0% | 59/67 | 88.1% | 87.3% |
5 × 104 | 157/170 | 92.4% | 54/67 | 73.0% | 157/177 | 88.7% | 54/67 | 80.6% | 86.5% |
104 | 163/185 | 88.1% | 45/59 | 76.3% | 163/177 | 92.1% | 45/67 | 67.2% | 85.2% |
103 | 168/202 | 83.2% | 33/42 | 78.6% | 168/177 | 94.9% | 33/67 | 49.3% | 82.4% |
HBV, hepatitis B virus; LAMP, loop-mediated isothermal amplification; qPCR, quantitative PCR; PPV, positive predictive values; NPV, negative predictive values.
In addition, significant viremic samples were further analyzed for correlation with time to turbidity thresholds derived from turbidity-based LAMP assay [12]. Unfortunately, linear regression pattern was not found; therefore, we concluded that the time to turbidity threshold could not be used to quantify HBV viral load in turbidity-based LAMP assay.
The major cost difference between qPCR and LAMP was the equipment used in each method. A quantitative thermal cycler machine price ranges between 30,000 and 50,000 USD, whereas a turbidimeter price used in this optimization was at 2,000 USD. In our design, we expected the local facilities to use a heat block (200–1200 USD), or a waterbath (50–100 USD). Since LAMP relied on an equipment capable of maintaining a single temperature for 30–60 min, the more economical choices of equipment selection can be considered. Moreover, the heat treatment method was not only feasible and time-saving, but also economical for omitting the DNA extraction process. Currently, DNA extraction kit price ranges between 2 and 5 USD/sample and requires about 2 h processing time. Cost and method comparison were summarized in
Cost comparison between quantitative PCR and LAMP
Methods | Price (per equipment) | Price (per reaction) | Price (per test, include positive and negative controls) | ||
---|---|---|---|---|---|
Equipment | DNA extraction | Amplification reagents | Detection | Total | |
Quantitative PCR | qPCR 30,000–50,000 USD | 5 USD | 30 USD | – | 105 USD |
LAMP | Turbidimeter 2000 USD, or heat block (200–1200 USD), or waterbath (50–100 USD) | – | 20 USD | – | 60 USD |
LAMP, loop-mediated isothermal amplification; PCR, polymerase chain reaction.
This assay development was mainly determined to answer the obstetrician’s request for an antenatal screening in rural area. Turbidity-based HBV LAMP coupled with heat treatment method was chosen because of acceptable accuracy, simplified methods, rapidity, and cost-effectiveness. The assay sensitivity to detect HBV DNA was 100 copies/reaction (2 × 105 IU/mL) and no cross detection to other viruses was observed. The positive results can be determined by turbidimeter between 22.76 ± 1.58 and 31.48 ± 1.41 min. In clinical samples, the assay performed 90.12% sensitivity, 83.33% specificity, and 87.40% accuracy comparable to previously developed HBV LAMP assays. Meta-analysis of 12 HBV LAMPs literatures performing 494 cases revealed the average assay sensitivity, and specificity at 0.922 (95% confidence interval [CI]: 0.905–0.937), and 0.860 (95% CI: 0.818–0.896), respectively [22]. Therefore, we concluded that our turbidity-based HBV LAMP coupled with heat treatment method was similarly accurate to the previously developed HBV LAMP methods and can be implemented to the national-level HBV antenatal diagnostic test.
Our turbidity-based HBV LAMP interpreted positive and negative results at the 2 × 105 IU/mL HBV DNA cutoff value at 89.02% and 84.90%, respectively (
Several detection platforms were integrated to LAMP such as lateral flow dipstick, enzyme-linked immunosorbent assay (ELISA), and microfluidic chip using antibody-labeled streptavidin–biotin, fluorescent-labeled probes, giant magnetoresistive (GMR) sensors, probe-functionalized nanoparticles, magnetic nanoclusters (MNCs), and line probe assay (LiPA) [9, 23]. Incorporating one of the platforms into LAMP detection system could potentially increase the sensitivity, as well as the cost per reaction. Further assay development toward field implementation might emphasize on reducing interpersonal variation by transferring to lateral flow dipstick or microfluidic chip platform while maintaining with the low price for affordability.