Search Results

1 - 10 of 36 items :

Clear All

Hansen BE, Buster EH, Steyerberg EW, Lesaffre E, Janssen HL. Prediction of the response to peg-interferon-alfa in patients with HBeAg positive chronic hepatitis B using decline of HBV DNA during treatment. J Med Virol 2010;82:1135-1142. 19 Ghany MG, Strader DB, Thomas DL, Seeff LB. American Association for the Study of Liver Diseases. Diagnosis, management, and treatment of hepatitis C: an update. Hepatology 2009;49:1335-1374.

Abstract

Objective The clinical significance of differential distribution of hepatitis B virus (HBV) nucleocapsid antigen in hepatocytes remains unknown. The goal of this study is to determine the relationship between distinct HBV core antigen distribution pattern and alanine transaminase (ALT), liver histological inflammatory activity grades, serum HBeAg status and HBV DNA level.

Methods Total of 958 cases with chronic hepatitis B were recruited into this study. Liver function tests, serum HBV DNA level, serological HBV markers and liver immunohistochemistry were examined according to the conventional instructions. Chi Square tests were performed to analyze the differences among these groups.

Results It was found that 552 (58%) cases were tested positive for HBV core antigen by immunohistochemical staining. Cytoplasmic hepatitis B core antigen (HBcAg) expression correlated with ALT level and serum HBV DNA and liver inflammatory activity scores, however, nuclear HBcAg expression in hepatocytes was associated with normal ALT level, lower liver inflammatory activity score and higher serum HBV DNA level and rate of HBeAg positivity. Both nuclear and cytoplasmic HBcAg expression in hepatocytes associated with a middle ALT level and liver inflammatory activity score, higher rate of serum detectable HBeAg and a higher HBV DNA level. However, undetectable core antigen was related to a lower ALT level and histological inflammatory activity grade, lower positive HBeAg rate and HBV DNA level.

Conclusions Undetectable liver HBcAg is associated with HBV clearance, ALT normalization and hepatitis B e antigen (HBeAg) seroconversion, and cytoplasmic HBcAg expression associated with higher hepatic inflammatory activity. However, nuclear HBcAg expression correlates with immune tolerance characterized with normal ALT and lower liver inflammatory activity, higher HBV replication level and higher rate of HBeAg positivity.

to a cure?” Digestive and Liver Disease. 2015; 47: 836-841. 10. Martinot-PeginouxM et al.: HBsAg quantification to predict natural history and treatment outcome in chronic hepatitis B patients. Clin Liver Dis. 2013, 17: 399-412. 11. Samant H, Joshi Aet al. “Correlation of QuantitativeHBsAg with Quantitative HBV DNA in Different Phases of Chronic Hepatitis B (CHB) Patients.”J Liver Res Disord Ther. 2016; 1(3). 12. Thompson AJ, Nguyen T, Iser D, et al. “Serum hepatitis B surface antigen and hepatitis B e antigen titers: disease phase influences correlation with viral

recruited and sub-classified into 3 groups: Group I : 48 chronic HBV patients with persistently normal ALT level and HBV DNA level < 2000 IU/mL for ≥ 6 months; Group II : 48 chronic HBV patients with CHB with persistently elevated ALT and HBV DNA level ≥ 2000 IU/mL for ≥ 6 months; Group III : 25 apparently healthy subjects with normal liver enzymes and negative hepatitis viral markers were taken as the control group. Inclusion criteria Adults of both genders ≥ 18 years old with proven chronic HBV infection (defined as HBsAg+ and Positive HBV DNA PCR [polymerase chain

. Seroconversion is mostly associated with a decrease in serum HBV DNA levels. However, sometimes following acute exposure with the absence of HBeAg and appearance of anti-HBe, the patient also has high levels of HBV DNA and continues to have active liver disease. These are the patients in whom HBV has undergone mutations that prevent decreased production of HBeAg. HBV DNA is a marker of viremia and infectivity, and it may be detected 2–3 weeks before the appearance of HBsAg, and may remain detectable even after HBsAg seroconversion to anti-HBs. Some HBsAg-positive patients, who

–1685 GGACTCTTGGACTCTCAGCAATGT Nyan et al. [ 19 ] Ref_F3 530–249 TCCTCACAATACCGCAGAGT S and P gene Ref_B3 402–421 GCAGCAGGATGAAGAGGAAT Ref_FIP 305–326 GTTGGGGACTGCGAATTTTGGC-TTTT-TAGACTCGTGGTGGACTTCT 251–270 Ref_BIP 333–354 TCACTCACCAACCTCCTGTCCT-TTTT-AAAACGCCGCAGACACAT 379–396 Ref_LF 271–294 GGTGATCCCCCTAGAAAATTGAG Ref_LB 357–378 AATTTGTCCTGGTTATCGCTGG F3, outer forward primer; B3, outer backward primer; FIP, forward inner primer; BIP, backward inner primer; LF, loop forward primer; LB, loop backward primer. Standard HBV DNA preparation The plasmid pUC19 containing a whole HBV genome AB

2008;49(5):695-701. 16. Sun J, Wang Z, Ma S, Zeng G, Zhou Z, Luo K, et al. Clinical and virological characteristics of lamivudine resistance in chronic hepatitis B patients: a single center experience. J Med Virol 2005;75(3):391-398. 17. Pan XP, Li LJ, Du WB, Li MW, Cao HC, Sheng JF. Differences of YMDD mutational patterns, precore/core promoter mutations, serum HBV DNA levels in lamivudine-resistant hepatitis B genotypes B and C. J Viral Hepat 2007;14(11):767-774. 18. Xu Z, Liu Y, Xu T, Chen L, Si L, Wang Y, et al. Acute hepatitis B infection associated with drug

historical information, HBsAg and anti-HCV status of patients were evaluated retrospectively while preserving the anonymity of the patients included in this study. In all centers, HBsAg and anti-HCV serology was performed using a third-generation ELISA (Abbott Laboratories, North Chicago, IL, USA). Assays for HBV DNA and HCV RNA were used to assess the HBsAg seropositive and anti-HCV seropositive HD patients further. Serum HBV DNA was determined using a quantitative polymerase chain reaction (PCR) assay (COBAS TaqMan HBV test, detection limit 12 IU/ml; Roche Diagnostics

after liver transplantation. Gastroenterology 2008;134:1890-1899. 14 Hussain M, Soldevila-Pico C, Emre S, Luketic V, Lok AS; NIH HBVOLT Study Group. Presence of intrahepatic (total and ccc) HBV DNA is not predictive of HBV recurrence after liver transplantation. Liver Transpl 2007;13:1137-1144. 15 Hosaka T, Suzuki F, Kobayashi M, Hirakawa M, Kawamura Y, Yatsuji H, et al. HBcrAg is a predictor of post-treatment recurrence of hepatocellular carcinoma during antiviral therapy. Liver Int 2010;30:1461-1470. 16 Wong DK, Tanaka Y, Lai CL, Mizokami M, Fung J, Yuen MF

Cancer Res 2008; 27:15. 14. Yuen MF, Tanaka Y, Shinkai N, Poon RT, But DY, Fong DY, et al. Risk for hepatocellular carcinoma with respect to hepatitis B virus genotypes B/C, specific mutations of enhancer II/ core promoter/precore regions and HBV DNA levels. Gut2008;57(1):98-102. 15. Hann HW. Active antiviral therapy for chronic hepatitis B and hepatocellular carcinoma. Minerva Gastroenterol Dietol 2008;54(1):19-30. 16. Zang H, Chen GF, Ji D, Shao Q, Li F, Wang HF, et al. The study of the relationship between serum model and viral load for hepatitis B patients with