Search Results

You are looking at 1 - 10 of 14 items for :

  • nuclear program x
  • Microbiology, Virology and Infection Epidemiology x
Clear All
Open access

B. Kiziewicz

[1] Artigas, P., Periago, M. V., Kiziewicz, B., Bargues, M. D., Mas-Coma, S. (2004): Molecular characterization of Fasciola hepatica from the wild natural host Bison bonasus of Poland. In Programme and Abstracts of IX European Multicoloquium of Parasitology, July 18–23, 2004. Valencia, Spain, 2001, pp. 287–288 [2] Bargues, M. D, Vigo, M., Horak, P., Dvorak, J., Patzner, R. A., Pointier, J. P., Jackiewicz, M., Meierbrook, C., Mas-Coma, S. (2001): European Lymnaeidae (Mollusca: Gastropoda), intermediate hosts of

Open access

T. Scholz, A. Šimková, J. Rasamy Razanabolana and R. Kuchta

References B auer , O.N., M usselius , V.A., S trelkov , Y.A. (1973): Diseases of Pond Fishes . Jerusalem, Israel, Israel Programme for Scientific Translations, 220 pp. B enstead , J.P., D e R ham P.H., G attolliat , J.-L., G ibon , F.-M., L oiselle , P.V., S artori , M., S parks J.S., S tiassny , M.L.J. (2003): Conserving Madagascar’s freshwater biodiversity. BioScience , 53: 1101 – 1111. DOI: 10.1641/0006-3568(2003)053[1101:CMFB]2.0.CO;2 B rabec , J., K uchta , R., S cholz , T., L ittlewood , D.T.J. (2016): Paralogues of nuclear ribosomal

Open access

J. S. Dar, B. A. Ganai, R. A. Shahardar and U. R. Zargar

erella , P., S aid , K., S limane , B.B. (2011). Molecular characterization of Fasciola spp. From the endemic area of northern Iran based on nuclear ribosomal DNA sequences. Exp. Parasitol. , 128(3): 196 – 204. DOI: 10.1016/j. exppara.2011.03.011 A nonymous (1995). Control of foodborne trematode infections. Report of a WHO Study Group, World Health Organ. Tech. Rep. Ser., 849: 1 – 157 A nuracpreeda , P., W anichanon , C., S obhon , P. (2009). Fasciola gigantica : immunolocalization of 28.5 kDa antigen in the tegument of metacercaria and juvenile

Open access

J. Segovia, T. Vila, J. Vargas, M. Fuentes and C. Feliu

. [18] Harkness, J. E., Turner, P. V. vande Woude, S., Wheler, C. L. (2010): Biology and Medicine of rabbits and rodents. 5th Edition. Iowa, USA, Blackwell Publishing, 472 pp. [19] Haukisalmi, V., Hardman, L. M., Foronda, P., Feliu, C., Henttonen, H. (2010): Systematic relationships of Mosgovoyia Spasskii, 1951 (Cestoda: Anoplocephalidae) and related genera inferred from mitochondrial and nuclear sequence data. Syst. Parasitol., 77: 71–79. DOI: 10.1007/s11230-010-9264-9 http://dx.doi.org/10.1007/s11230

Open access

J. Vadlejch, D. Lukešová, J. Vašek, P. Vejl, P. Sedlák, Z. Čadková, I. Langrová, I. Jankovská and O. Salaba

between nuclear and mitochondrial DNA sequences in avian malaria parasites: multiple cases of cryptic speciation? Evolution, 58(7): 1617–1621 http://dx.doi.org/10.1111/j.0014-3820.2004.tb01742.x [5] Blouin, M. S., Yowell, C. A., Courtney, C. H., Dame, J. B. (1997): Haemonchus placei and Haemonchus contortus are distinct species based on mtDNA evidence. Int. J. Parasitol., 27(11): 1383–1387 http://dx.doi.org/10.1016/S0020-7519(97)00125-2 [6] Brasil, B. S., Nunes, R. L., Bastianetto, E., Drummond, M. G., Carvalho, D. C

Open access

V. Athokpam and V. Tandon

of the human schistosomes. Mol. Phylogenet. Evol., 4: 103–109 http://dx.doi.org/10.1006/mpev.1995.1011 [4] Bowles, J., Hope, M., Tiu, W.U., Liu, X., Mcmanus, D. P. (1993): Nuclear and mitochondrial genetic markers highly conserved between Chinese and Philippine Schistosoma japonicum. Acta. Trop., 55: 217–229 http://dx.doi.org/10.1016/0001-706X(93)90079-Q [5] Chubb, J. C. (1977): Seasonal occurrence of helminthes in freshwater fishes. Part I. Monogenea. Adv. Parasitol., 15: 133–199 http://dx.doi.org/10.1016/S0065

Open access

V. Šnábel, C. Calma, S. O. Georgescu, S. Cavallero, S. D’Amelio, Z. Vasilková and A. Ito

mitochondrial and nuclear markers to evaluate the degree of genetic cohesion among Echinococcus populations. Exp. Parasitol. , 119(4): 453 – 459. DOI: 10.1016/j.exppara.2008.02.004 B andelt , H., F orster , P., R öhl , A. (1999): Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. , 16(1): 37 – 48. DOI: 10.1093/oxfordjournals.molbev.a026036 B agrade , G., Š nábel , V., R omig , T., O zoliņš , J., H üttner , M., M iterpáková , M., Š evcová , D., D ubinský , P. (2008): Echinococus multilocularis is a frequent parasite of red foxes

Open access

S. Düşen and H. Yaka

frogs (Hyla, Hylidae, Amphibia) as inferred from nuclear and mitochondrial DNA variation, with a description of a new species. Mol. Phylogenet. Evol., 55: 1146–1166. DOI: 10.1016/j.ympev.2010.03.015 http://dx.doi.org/10.1016/j.ympev.2010.03.015 [28] Hassl, A. R (2010): A case of a facultative life-cycle diversification in the fluke Pleurogenoides sp. (Lecithodendriidae, Plagiorchiida). Wien Klin. Wochenschr. Suppl. 3: 91–93. DOI: 10.1007/s00508-010-1444-8 http://dx.doi.org/10.1007/s00508-010-1444-8 [29] Hassl, A. R

Open access

Muyao Zhang, Xing Wei and Zhenfei Wang

initiating the proliferation of HBV [ 15 ]. Duan et al. found that HBx protein can increase intracellular oxidative stress and activate the transcription factors signal transducer and activator of transcription (STAT3), nuclear factor kappa B (NFκB), and other factors by causing mitochondrial damage, which results in the acceleration of hepatoma cell proliferation [ 15 ]. Long noncoding RNA high expression in HCC (lncRNA-HEIH) is a carcinogenic lncRNA overexpressed in hepatoma. It accelerates the malignant progression of hepatoma by promoting the abnormal proliferation

Open access

Y. Zeng, W. Ye, Z. Zhang, H. Sun, L. Yong, Y. Huang, K. Zhao, H. Liang and J. Kerns

al ., 2005 ). Primers for large subunit 28S amplification and DNA sequencing were forward primer D2a (5’ ACAAGTACCGTGAGGGAAAGTTG 3’) and reverse primer D3b (5’ TGCGAAGGAACCAGCTACTA 3’) ( Nunn, 1992 ). The 25 μl PCR was performed using TaqMix DNA polymerase (Guangzhou Dongsheng Biotech Ltd., Guangzhou, China) according to the manufacturer’s protocol. The thermal cycler program for PCR was as follows: denaturation at 95 °C for 5 min followed by 35 cycles of denaturation at 94 °C with 30 s; annealing at 55 °C for 45 s, and extension at 72 °C for 2 min. A final