Molecular detection and genetic diversity of porcine circovirus type 3 in commercial pig farms in Xinjiang province, China

Qiao Mengfan
  • College of Animal Science and Technology, Shihezi University, Shihezi, Xinjiang, 832003, China
  • School of Biotechnology, Central South University, Changsha, Hunan, 410012, China
  • Search for other articles:
  • degruyter.comGoogle Scholar
, Wang Xifeng
  • College of Animal Science and Technology, Shihezi University, Shihezi, Xinjiang, 832003, China
  • Search for other articles:
  • degruyter.comGoogle Scholar
, Zhang Guowu
  • College of Animal Science and Technology, Shihezi University, Shihezi, Xinjiang, 832003, China
  • Search for other articles:
  • degruyter.comGoogle Scholar
, Meng Qingling
  • College of Animal Science and Technology, Shihezi University, Shihezi, Xinjiang, 832003, China
  • Search for other articles:
  • degruyter.comGoogle Scholar
, Qiao Jun
  • Corresponding author
  • College of Animal Science and Technology, Shihezi University, Shihezi, Xinjiang, 832003, China
  • Email
  • Search for other articles:
  • degruyter.comGoogle Scholar
, Wang Lixia
  • College of Animal Science and Technology, Shihezi University, Shihezi, Xinjiang, 832003, China
  • Search for other articles:
  • degruyter.comGoogle Scholar
, Cai Kuojun, Zhang Jinsheng
  • Center for Animal Disease Prevention and Control, Tacheng, Xinjiang, 834700, China
  • Search for other articles:
  • degruyter.comGoogle Scholar
, Zhang Zaichao
  • Center for Animal Disease Prevention and Control, Changji, Xinjiang, 831500, China
  • Search for other articles:
  • degruyter.comGoogle Scholar
, Yu Weiwei, Peng Yelong and Cai Xuepeng
  • State Key Laboratory of Veterinary Etiological Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu, 730046, China
  • Search for other articles:
  • degruyter.comGoogle Scholar

Abstract

Introduction

Porcine circovirus type 3 (PCV3) is a newly discovered porcine circovirus. The molecular characteristics and genetic evolution of PCV3 in Xinjiang province, China still being unclear, the aim of the study was their elucidation.

Material and Methods

A total of 393 clinical samples were collected from pigs on commercial farms in nine different regions of Xinjiang and phylogenetic analysis based on full-length Cap genes was performed.

Results

The prevalence at farm level was 100%, while in all the tested samples it was 22.39%. Nine PCV3 strains were detected in Xinjiang province and they shared 98.9–99.3% nucleotide and 97.5–100.0% Cap gene amino acid sequence identities with other epidemic strains from China and abroad. Compared with other epidemic strains of PCV3, there were 26 base mutation sites in the Cap gene in the nine Xinjiang strains, resulting in the mutation of amino acids at positions 20, 24, 75, 77, 108, 111 and 206. Phylogenetic analysis showed that these strains can be divided into two different genetic groups, to the first of which five strains affiliated and divided between subgroups 1.1 and 1.2, and to the second of which the other four strains affiliated and similarly divided between subgroups 2.1 and 2.2.

Conclusion

PCV3 circulates widely among commercial pig farms in Xinjiang province, China, and displays obvious genetic diversity. The results provide epidemiological information useful for the prevention and control of PCV3 infection in the pig industry.

Introduction

Porcine circovirus (PCV) belongs to the Circoviridae family, Circovirus genus, and is one of the smallest animal viruses (19, 29). As a non-enveloped virus with single-stranded DNA (ssDNA), PCV can be divided into three types: PCV1, PCV2, and PCV3 (20). The last of them was identified in the United States in 2016 and described as an emerging virus there (21). Subsequently, PCV3 was detected in South America (Brazil) (25), Asia (China, Korea, Japan, and Thailand) (7, 8, 11, 12, 26) and Europe (Poland, Denmark, Italy, Spain, the UK, Germany, Russia, and Sweden) (1, 4, 23, 28, 29), causing widespread concern in the pig industry around the world (13, 22).

The existing studies show that the PCV3 genome is 2,000 bp in length, which is similar to the PCV1 and PCV2 genomes, and includes three open reading frames ORF1, ORF2, and ORF3 (19). ORF1 encodes a replication-associated protein, ORF2 encodes a capsid protein, and ORF3 encodes a protein unique to it. In recent years, studies of the molecular characteristics and pathogenicity of PCV3 have received increasing attention due to the widespread infection in pigs all over

the world (5, 13). It has been reported that PCV3 can infect a host alone or co-infect with other pathogens (32). Infection is documented as being associated with swine reproductive failure, fever, respiratory diseases, and multi-system inflammation. However, the pathogenesis of PCV3 and its role in co-infections remains unclear (5, 19, 31, 32). In addition, it has been noted that PCV3 infection can cause diseases such as congenital tremor and myocarditis in newborn piglets (4, 9, 17).

Xinjiang province, located in the northwest of China, covers an area of 1,665,900 km2 and is the most important animal husbandry region in China. In recent years, with the rapid development of the pig industry in Xinjiang, the number of live pigs has reached 4.1 million, and raising pigs has become an important means for farmers to increase their incomes. However, with the continuous intensification and expansion, reproductive disorders and infectious diseases of the respiratory and digestive tracts of pigs have also surged in prevalence, which has caused huge economic losses to the pig industry. As a newly discovered cross-border transmissible virus, the current infection status and molecular characteristics of PCV3 in Xinjiang are still unclear.

The purpose of the present study was to investigate the infection status and explore the molecular characteristics of Xinjiang strains of PCV3 in commercial pigs, which will provide useful molecular data for understanding the epidemic pattern of this infectious disease.

Material and Methods

Source and collection of samples. The clinical samples were collected in the two-year period 2017–2018 from animals from nine commercial pig farms in nine regions of Xinjiang province (Altai, Tacheng, Yili, Shihezi, Urumqi, Changji, Korla, Aksu, and Kashi) (Fig. 1A). A total of 393 samples were collected from pigs with clinical symptoms (fever, diarrhoea, and coughing), including 79 lymph nodes, 93 spleens, 62 lungs, 57 pleural effusions, and 102 serum samples (Table 3). These samples were sealed, placed in ice boxes, and transported at low temperature to the Xinjiang Key Laboratory of Animal Disease Prevention and Control.

Fig. 1
Fig. 1

A – geographic distribution of sampled farms, B – positive rates of PCV3 infection in different commercial pig farms in Xinjiang province, China

Note: Positive rate was determined based on PCR analysis of clinical samples.

Citation: Journal of Veterinary Research 63, 4; 10.2478/jvetres-2019-0071

Primer design and synthesis. A pair of primers were designed and synthesised according to the PCV3 sequence (KX778720.1) deposited in GenBank (http://www.ncbi.nlm.nih.gov/genbank/) The FP1–RP1 primer was used for PCR detection of the positive samples, and the FP2–RP2 primer was used for the full-length PCR of cap from the PCV3 Xinjiang epidemic strain (Table 2). The primers were synthesised by Sangon Biotech Co., Ltd (Shanghai, China).

Table 1

GenBank accession numbers of PCV3 strains

StrainAccession number
2164KX458235
PCV3-US/MN2016KX898030
PCV3-US/SD2016KX966193
PCV3/CN/Fujian-5/2016KY075986
PCV3/CN/Henan-13/2016KY075988
PCV3/CN/Jiangxi-62/2016KY075989
PCV3/CN/Chongqing-150/2016KY075992
CN/Hubei-618/2016KY354039
CCV-AKY363870
CCV-BKY363871
CCV-CKY363872
PCV3-China/GD2016KY418606
PCV3/KU-1601KY996337
PCV3/KU-1604KY996340
PCV3/KU-1606KY996342
PCV3/KU-1608KY996344
PCV3/KU-1609KY996345
P1705SCYC/2017MF063070
16R927/2016MF063071
PCV3-BR/RS/6MF079253
PCV3/CN/Jiangxi-B1/2017MF589107
PCV3/CN/Jiangxi-S1/2017MF589133
PCV3/CN/Guangdong-CH/2016MF589112
PCV3/CN/Guangdong-X1/2016MF589118
309MF589652
JX-1/CH/2017MF677838
1621_Italy_2017MF805719
4332-5_Denmark_2017MF805723
4332-7_Denmark_2017MF805724
DE2.8MG014377
DE19.15MG014367
DE27.16MG014370
PCV3/HU/Szerencs/2017MG595741
PCV3-RU/TY17MG679916
PCV3-JSXY-201701MG868940
PCV3-HBWH-201703MG868941
PCV3-SH-201705MG868945
SDMG947596
PCV3-CN2018HLG-5MH277111
PCV3-CN2018JL-1MH277112
PCV3-CN2018LN-3MH277117
COL/Cundinamarca2/2018MH327785
CN/Xinjiang-AK16/2018MK562412
CN/Xinjiang-AL5/2018MK562413
CN/Xinjiang-CH29/2018MK562414
CN/Xinjiang-KA2/2018MK562415
CN/Xinjiang-KO17/2018MK562416
CN/Xinjiang-SH6/2018MK562417
CN/Xinjiang-TA36/2018MK562418
CN/Xinjiang-UR22/2018MK562419
CN/Xinjiang-YI7/2018MK562420
29160NC031753
Table 2

List of primer sequences used in this study

Primer nameNucleotide sequencePosition in referenceProduct size
(5′→ 3′)sequence(bp)
FP1CCGTAGAAGTCTGTCATTCCAG1383–1404
RP1AAGCCCTGGCACGCCAACCAC1796–1816434
FP2TTAGAGAACGGACTTGTAACGA1343–1364
RP2ATGAGACACAGAGCTATATTCAG1965–1987645
Table 3

Detection of PCV3 infection in different samples from commercial pig farms in Xinjiang province, China

Clinical samplesNumber of samplesNumber of positive samplesPositive rate (%) of PCV3
Lymph nodes792936.71 (29/79) a
Spleen932223.66 (22/93) a
Lung62914.52 (9/62) b
Pleural effusion571322.81 (13/57) a
Serum1021514.71 (15/102) b
Total3938822.39 (88/393)

Note: Different superscript letters (a, b) in one column means significant difference (P < 0.05)

DNA isolation of collected samples. Briefly, the samples were placed in a grinder and milled with 1.5 mL of sterile physiological saline. The milled solution was collected in a 2.0 mL EP tube and frozen and thawed three times. Samples were centrifuged at 12,000 rpm for 5 min, and then the supernatant was collected for DNA extraction using a MiniBEST Viral RNA/DNA Extraction Kit (TaKaRa Bio, Shiga, Japan) according to the manufacturer’s instructions. The extracted DNA was used as the template for PCR detection.

PCR detection. PCR detection of nucleic acids in positive samples was performed using FP1–RP1 primers. The PCR reaction mix included: 21 μL of water, 1 μL (0.2 μmol/L) of each FP1–RP1 primer, 25 μL of 2× Premix Ex Taq (TaKaRa Bio), and 2 μL of DNA template. Reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 20 s, annealing at 60°C for 30 s and extension at 72°C for 30 s for 35 cycles, and final extension at 72°C for 10 min. PCR products were detected by 1.5% agarose gel electrophoresis after amplification and the detection results were statistically analysed.

Amplification, cloning, and sequencing of the full length Cap gene from the PCV3 Xinjiang strain.

A randomly chosen sample that showed positive PCR results was selected from each Xinjiang provincial region, and PCR amplification of the PCV3 full-length cap gene was performed using FP2–RP2 primers. The PCR reaction system was the same as mentioned above. Reaction conditions were as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 20 s, annealing at 60°C for 30 s and extension at 72°C for 50 s for 30 cycles, and extension at 72°C for 10 min. Then the PCR product was detected by 1.5% agarose gel electrophoresis. It was recovered by a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), and the recovered fragment was cloned into a pMD18-T vector (TaKaRa Bio). The positive clone was subsequently screened by PCR and sent for sequencing by Sangon Biotech Co., Ltd. Three positive clones for each sample were selected and each clone was sequenced three times. The sequence of positive clones from identical sequencing results was used for alignment analysis.

Phylogenetic analysis of Cap gene in PCV3 Xinjiang epidemic strains. The nine DNA sequences of cap genes from PCV3 Xinjiang epidemic strains and 43 domestic and foreign strains (Supplementary Table 2) of different regions were compared by DNAstar 7.1 (DNASTAR Inc., USA) and Clustal X 2.1 (http://www.clustal.org/) software, and the homology and the genetic variation characteristics of cap gene in PCV3 Xinjiang epidemic strains were analysed. A cap gene phylogenetic tree from PCV3 epidemic strains was constructed and the genetic evolution relationship between different strains was analysed by Mega software version 7.0 (https://www.megasoftware.net/)

Statistical analysis. Statistical analysis was conducted using SAS software (Version 9.1, SAS Institute, Inc., Cary, NC, USA). The detection rates on different commercial pig farms in Xinjiang Province were compared using a chi-squared (x2) test. The value of P < 0.05 was considered statistically significant, while P < 0.01 was considered an extremely significant difference.

Results

PCV3-specific nucleic acids were detected in samples from nine commercial pig farms in Xinjiang province (Fig. 1B, Supplementary Fig.1). The prevalence of PCV3 in pig farms was 100.0% (12/12), while in all the tested samples it was 22.39% (88/393). The detection rate of PCV3 in different commercial pig farms ranged from 15.79% to 28.30% (Supplementary Table 1). By sample type 14.52–36.71% of tested material was positive. Among them, the detection rate was the highest in lymph nodes (36.71%, 29/79), which was significantly different from lung and serum samples (P < 0.05) (Table 3). The PCR results indicated that PCV3 infection was common in the commercial pig farms of Xinjiang.

The cap gene was amplified from all nine PCR-positive samples in fragments all of 645 bp, which was consistent with the expected size (Supplementary Fig. 2). The cap genes from nine PCV3 Xinjiang epidemic strains (named CN/Xinjiang-SH6/2018, CN/Xinjiang-TA36/2018, CN/Xinjiang-AL5/2018, CN/Xinjiang-UR22/2018, CN/Xinjiang-AK16/2018, CN/Xinjiang-YI7/2018, CN/Xinjiang-KO17/2018, CN/Xinjiang-CH29/2018, and CN/Xinjiang-KA2/2018) were submitted to GenBank (accession numbers MK562412– MK562420). The cap genes of Xinjiang strains shared 98.9–99.3% identity and the nucleotide sequences shared 97.5–100.0% identity with other strains of PCV3 from domestic and foreign farms (Supplementary Table 3).

Fig. 2
Fig. 2

Phylogenetic analysis of PCV3 strains based on the full-length cap gene using the neighbour-joining method

Note: The nucleotide sequences of cap gene of PCV3 strains obtained in this study and available in GenBank were used to construct a phylogenetic tree by the neighbour-joining method. Bootstrap values were calculated with 1,000 replicates. Vertical lines are used to indicate groups (or subgroups) which were referred to in the text. Filled circles indicate the PCV3 strains identified in this study

Citation: Journal of Veterinary Research 63, 4; 10.2478/jvetres-2019-0071

Among 52 epidemic strains of PCV3 from different regions of the world (Supplementary Table 2), 73 nucleotide variation sites in the cap gene were identified, which caused 18 mutation sites in the amino acid sequence of the cap protein. In the nine PCV3 Xinjiang strains, there were 31 nucleotide variation sites in the cap gene (Supplementary Fig. 3), leading to the mutation of amino acids at positions 20, 24, 75, 77, 108, 111 and 206 of the cap protein.

Phylogenetic analysis based on the cap gene showed that PCV3 strains can be divided into two genetic groups. Group 1 can be divided into subgroups 1.1 and 1.2, and Group 2 can likewise be divided into subgroups 2.1 and 2.2 (Fig. 2). The nine Xinjiang strains resolved to all four subgroups: four belonged to subgroup 1.1, one to subgroup 1.2, two to subgroup 2.1, and two to subgroup 2.2 (Table 4), showing obvious genetic diversity.

Table 4

Genetic diversity of PCV3 strains circulating in commercial pig farms in Xinjiang province, China

PCV3 strainsGroupSubgroup
CN/Xinjiang-SH6/201811.1
CN/Xinjiang-TA36/201811.1
CN/Xinjiang-AL5/201811.2
CN/Xinjiang-UR22/201811.1
CN/Xinjiang-YI7/201822.1
CN/Xinjiang-CH29/201822.2
CN/Xinjiang-AK16/201822.1
CN/Xinjiang-KO17/201822.2
CN/Xinjiang-KA2/201811.1

The GenBank accession numbers of 52 strains PCV3 are given in Table 1.

Discussion

PCV2 is still one of the most important viruses threatening the pig industry (11, 20). Due to the widespread use of commercial vaccines in Chinese pig herds, PCV2 infection has been controlled to some extent (31). However, since PCV3 was first discovered in 2016, PCV3 infection has occurred on pig farms in more than 10 provinces including Jiangxi, Hubei, Henan, Chongqing, Fujian, Guangdong, Hunan, and Jiangsu, causing great damage to the Chinese pig industry (3, 16, 18, 19, 24, 27). Some studies showed that PCV3 infection was associated with abortion, respiratory failure, and diarrhoea in weaned piglets (10, 31); however, the pathogenesis of PCV3 was still unclear (5, 13). Therefore, it was urgent and necessary to carry out studies on the mechanisms of PCV3 infection, pathogenesis, and immunity (14, 15, 17).

The intensive pig farming system may contribute to the rapid spread of various infectious pathogens. In addition, the global trade in breeding pigs, semen, and pork also has important impact on the global spread of PCV (2, 22, 24). In this study, we examined samples from animals with clinical lesions in Xinjiang province, China. It was shown that PCV3 infection had occurred in pig populations, which may be related to the introduction of a large number of breeding pigs into Xinjiang from foreign countries and domestic provinces in recent years. Among the tested samples, PCV3 could be detected from lymph nodes, spleens, lungs, pleural effusion, and serum, the lymph nodes yielding very high detectable content. Assessment of the risk of PCV3 transmission and exploration of its role in cases of unknown aetiologies is an exigent need. It was reported that PCV3 could also infect pigs without any clinical lesions, and latent infection should consequently be further investigated in pigs without any clinical lesions.

The genetic and traceability analyses of PCV3 epidemic strains are of great significance for preventing and controlling this infectious disease (17, 18, 22). In this study, the nucleotide sequences of the cap gene from nine strains of PCV3 in Xinjiang shared high identities with other strains from China and abroad. However, it is worth noting that compared with the PCV3 29160 reference strain, there were only scattered point mutations in the amino acid sequence of cap protein and no base insertion or deletion sites. Considering the fact that cap protein is the only structural protein and main antigen of PCV3 (3, 19), it is still unclear whether the variation in these amino acid positions could cause the changes in its virulence and immunogenicity (33). Phylogenetic tree analysis based on the cap gene showed that PCV3 can be divided into two gene groups, which is consistent with the findings of Fux et al. (6). Notably, the nine PCV3 Xinjiang epidemic strains in this study belonged to different subgroups of two gene groups, displaying obvious genetic diversity. However, the intrinsic relationship between the genetic diversity of PCV3 and its biological properties such as virulence and immunogenicity requires further study, which may provide important information for the development of an effective vaccine to control PCV3 infection in the pig industry.

In summary, the present study demonstrated for the first time that PCV3 infection was common in commercial pig herds and had significant genetic diversity. Therefore, biosecurity should be a strengthened component in pig farm anti-epidemic measures, and disinfection regulations should be strictly enforced. Furthermore, breeding pigs should be quarantined before introduction to prevent PCV3 from spreading through long-distance cross-border transportation.

Conflict of Interest

Conflict of Interests Statement: The authors declare that there is no conflict of interests regarding the publication of this article.

Financial Disclosure Statement: This research was supported by the National Key Research and Development Program (No. 2017FD502300), Young and Middle-aged Leading Science and Technology Innovation Talents Plan of Xinjiang Corps (No. 2016BC001), and the Cooperation Project of Urumqi-Chongqinq in Science and Technology (No. Y161220001).

Animal Rights Statement: The authors declare that the experiments on animals were approved by the Research and Ethical Committee of Shihezi University.

Acknowledgments

We thank the field staff who provided the samples for this study.

Supplementary Figs 1–3 and Tables 1–3 comprise separate pdf files viewable online at http://content.sciendo.com/view/journals/jvetres/jvetres-overview.xml and doi: 10.2478/jvetres-2019-0071

References

  • 1

    Collins P.J., McKillen J., Allan G.: Porcine circovirus type 3 in the UK. Vet Rec 2017, 181, 599. doi: 10.1136/vr.j5505.

  • 2

    Dee S.A., Bauermann F.V., Niederwerder M.C., Singrey A., Clement T., de Lima M., Long C., Patterson G., Sheahan M.A., Stoian A.M.M., Petrovan V., Jones C.K., De Jong J., Ji J., Spronk G.D., Minion L., Christopher-Hennings J., Zimmerman J.J., Rowland R.R.R., Nelson E., Sundberg P., Diel D.G.: Survival of viral pathogens in animal feed ingredients under transboundary shipping models. PLoS One 2018, 13, e0194509. doi: 10.1371/journal.pone.0194509.

  • 3

    Deng J., Li X., Zheng D., Wang Y., Chen L., Song H., Wang T., Huang Y., Pang W., Tian K.: Establishment and application of an indirect ELISA for porcine circovirus 3. Arch Virol 2018, 163, 479–482. doi: 10.1007/s00705-017-3607-7.

  • 4

    Faccini S., Barbieri I., Gilioli A., Sala G., Gibelli L.R., Moreno A., Sacchi C., Rosignoli C., Franzini G., Nigrelli A.: Detection and genetic characterization of Porcine circovirus type 3 in Italy. Transbound Emerg Dis 2017, 64, 1661–1664. doi: 10.1111/tbed.12714.

  • 5

    Franzo G., Legnardi M., Tucciarone C.M., Drigo M., Klaumann F., Sohrmann M., Segalés J.: Porcine circovirus type 3: a threat to the pig industry? Vet Rec 2018, 182, 83. doi: 10.1136/vr.k91.

  • 6

    Fux R., Söckler C., Link E.K., Renken C., Krejci R., Sutter G., Ritzmann M., Eddicks M.: Full genome characterization of porcine circovirus type 3 isolates reveals the existence of two distinct groups of virus strains. Virol J 2018, 15, 25. doi: 10.1186/s12985-018-0929-3.

  • 7

    Ha Z., Xie C.Z., Li J.F., Wen S.B., Zhang K.L., Nan F.L., Zhang H., Guo Y.C., Wang W., Lu H.J., Jin N.Y.: Molecular detection and genomic characterization of porcine circovirus 3 in pigs from Northeast China. BMC Vet Res 2018, 14, 321. doi: 10.1186/s12917-018-1634-6.

  • 8

    Hayashi S., Ohshima Y., Furuya Y., Nagao A., Oroku K., Tsutsumi N., Sasakawa C., Sato T.: First detection of porcine circovirus type 3 in Japan. J Vet Med Sci 2018, 80, 1468–1472. doi: 10.1292/jvms.18-0079.

  • 9

    Kedkovid R., Woonwong Y., Arunorat J., Sirisereewan C., Sangpratum N., Kesdangsakonwut S., Tummaruk P., Teankum K., Assavacheep P., Jittimanee S., Thanawongnuwech R.: Porcine circovirus type 3 (PCV3) shedding in sow colostrum. Vet Microbiol 2018, 220, 12–17. doi: 10.1016/j.vetmic.2018.04.032.

  • 10

    Kedkovid R., Woonwong Y., Arunorat J., Sirisereewan C., Sangpratum N., Lumyai M., Kesdangsakonwut S., Teankum K., Jittimanee S., Thanawongnuwech R.: Porcine circovirus type 3 (PCV3) infection in grower pigs from a Thai farm suffering from porcine respiratory disease complex (PRDC). Vet Microbiol 2018, 215, 71–76. doi: 10.1016/j.vetmic.2018.01.004.

  • 11

    Kim S.C., Nazki S., Kwon S., Juhng J.H., Mun K.H., Jeon D.Y., Jeong C.G., Khatun A., Kang S.J., Kim W.I.: The prevalence and genetic characteristics of porcine circovirus type 2 and 3 in Korea. BMC Vet Res 2018, 14, 294. doi: 10.1186/s12917-018-1614-x.

  • 12

    Kim S.H., Park J.Y., Jung J.Y., Kim H.Y., Park Y.R., Lee K.K., Lyoo Y.S., Yeo S.G., Park C.K.: Detection and genetic characterization of porcine circovirus 3 from aborted fetuses and pigs with respiratory disease in Korea. J Vet Sci 2018, 19, 721–724. doi: 10.4142/jvs.2018.19.5.721.

  • 13

    Klaumann F., Correa-Fiz F., Franzo G., Sibila M., Núñez J.I., Segalés J.: Current knowledge on porcine circovirus 3 (PCV-3): A novel virus with a yet unknown impact on the swine industry. Front Vet Sci 2018, 5, 315. doi: 10.3389/fvets.2018.00315.

  • 14

    Klaumann F., Dias-Alves A., Cabezón O., Mentaberre G., Castillo-Contreras R., López-Béjar M., Casas-Díaz E., Sibila M., Correa-Fiz F., Segalés J.: Porcine circovirus 3 is highly prevalent in serum and tissues and may persistently infect wild boar Sus scrofa scrofa Transbound Emerg Dis 2019, 66, 91–101. doi: 10.1111/tbed.12988.

  • 15

    Klaumann F., Franzo G., Sohrmann M., Correa-Fiz F., Drigo M., Núñez J.I., Sibila M., Segalés J.: Retrospective detection of Porcine circovirus 3 (PCV-3) in pig serum samples from Spain. Transbound Emerg Dis 2018, 65, 1290–1296. doi: 10.1111/tbed.12876.

  • 16

    Li G., He W., Zhu H., Bi Y., Wang R., Xing G., Zhang C., Zhou J., Yuen K.Y., Gao G.F., Su S.: Origin, genetic diversity, and evolutionary dynamics of novel porcine circovirus 3. Adv Sci (Weinh) 2018, 5, 1800275. doi: 10.1002/advs.201800275.

  • 17

    Li G., Wang H., Wang S., Xing G., Zhang C., Zhang W., Liu J., Zhang J., Su S., Zhou J.: Insights into the genetic and host adaptability of emerging porcine circovirus 3. Virulence 2018, 9, 1301–1313. doi: 10.1080/21505594.2018.1492863.

  • 18

    Li X., Zhang C., Qiao M., Guo J., Xing G., Jin C., Wang J., Sun M., Tian K.: Molecular epidemiology of porcine circovirus type 3 infection in swine herds in China. Virol Sin 2018, 9. doi: 10.1007/s12250-018-0041-2.

  • 19

    Lu B., Qin Y., He Y., Liu L., Duan Q., Zhou Y., Li B., Chen Z., Liang J., Su Q., Bi B., Jiang D., Lu J., Zhao W.: Complete genome sequence of a novel porcine circovirus type 3 strain, CH/GX/1776D/2017, isolated from Guangxi, China. Genome Announc 2018, 6. pii: e00285–18. doi: 10.1128/genomeA. 00285-18.

  • 20

    Palinski R., Piñeyro P., Shang P., Yuan F., Guo R., Fang Y., Byers E., Hause B.M.: A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J Virol 2016, 91. pii: e01879–16. doi: 10.1128/JVI.01879-16.

  • 21

    Phan T.G., Giannitti F., Rossow S., Marthaler D., Knutson T.P., Li L., Deng X., Resende T., Vannucci F., Delwart E.: Detection of a novel circovirus PCV3 in pigs with cardiac and multisystemic inflammation. Virol J 2016, 13, 184. doi: 10.1186/s12985-016-0642-z.

  • 22

    Saraiva G.L., Vidigal P.M.P., Fietto J.L.R., Bressan G.C., Silva Júnior A., de Almeida M.R.: Evolutionary analysis of porcine circovirus 3 (PCV3) indicates an ancient origin for its current strains and a worldwide dispersion. Virus Genes 2018, 54, 376–384. doi: 10.1007/s11262-018-1545-4.

  • 23

    Stadejek T., Woźniak A., Miłek D., Biernacka K.: First detection of porcine circovirus type 3 on commercial pig farms in Poland. Transbound Emerg Dis 2017, 64, 1350–1353. doi: 10.1111/tbed.12672.

  • 24

    Sun J., Wei L., Lu Z., Mi S., Bao F., Guo H., Tu C., Zhu Y., Gong W.: Retrospective study of porcine circovirus 3 infection in China. Transbound Emerg Dis 2018, 65, 607–613. doi: 10.1111/tbed.12853.

  • 25

    Tochetto C., Lima D.A., Varela A.P.M., Loiko M.R., Paim W.P., Scheffer C.M., Herpich J.I., Cerva C., Schmitd C., Cibulski S.P., Santos A.C., Mayer F.Q., Roehe .P.M.: Full-genome sequence of porcine circovirus type 3 recovered from serum of sows with stillbirths in Brazil. Transbound Emerg Dis 2018, 65, 5–9. doi: 10.1111/tbed.12735.

  • 26

    Wen S., Sun W., Li Z., Zhuang X., Zhao G., Xie C., Zheng M., Jing J., Xiao P., Wang M., Han J., Ren J., Liu H., Lu H., Jin N.: The detection of porcine circovirus 3 in Guangxi, China. Transbound Emerg Dis 2018, 65, 27–31. doi: 10.1111/tbed.12754.

  • 27

    Xu P.L., Zhang Y., Zhao Y., Zheng H.H., Han H.Y., Zhang H.X., Chen H.Y., Yang M.F., Zheng L.L.: Detection and phylogenetic analysis of porcine circovirus type 3 in central China. Transbound Emerg Dis 2018, 65, 1163–1169. doi: 10.1111/tbed.12920.

  • 28

    Ye X., Berg M., Fossum C., Wallgren P., Blomström A.L.: Detection and genetic characterisation of porcine circovirus 3 from pigs in Sweden. Virus Genes 2018, 54, 466–469. doi: 10.1007/s11262-018-1553-4.

  • 29

    Yuzhakov A.G., Raev S.A., Alekseev K.P., Grebennikova T.V., Verkhovsky O.A., Zaberezhny A.D., Aliper T.I.: First detection and full genome sequence of porcine circovirus type 3 in Russia. Virus Genes 2018, 54, 608–611. doi: 10.1007/s11262-018-1582-z.

  • 30

    Zhai S.L., Chen S.N., Xu Z.H., Tang M.H., Wang F.G., Li X.J., Sun B.B., Deng S.F., Hu J., Lv D.H., Wen X.H., Yuan J., Luo M.L., Wei W.K.: Porcine circovirus type 2 in China: an update on and insights to its prevalence and control. Virol J 2014, 11, 88. doi: 10.1186/1743-422X-11-88.

  • 31

    Zhai S.L., Zhou X., Zhang H., Hause B.M., Lin T., Liu R., Chen Q.L., Wei W.K., Lv D.H., Wen X.H., Li F., Wang D.: Comparative epidemiology of porcine circovirus type 3 in pigs with different clinical presentations. Virol J 2017, 14, 222. doi: 10.1186/s12985-017-0892-4.

  • 32

    Zheng S., Shi J., Wu X., Peng Z., Xin C., Zhang L., Liu Y., Gao M., Xu S., Han H., Yu J., Sun W., Cong X., Li J., Wang J.: Presence of Torque teno sus virus 1 and 2 in porcine circovirus 3-positive pigs. Transbound Emerg Dis 2018, 65, 327–330. doi: 10.1111/tbed.12792.

  • 33

    Zou Y., Zhang N., Zhang J., Zhang S., Jiang Y., Wang D., Tan Q., Yang Y., Wang N.: Molecular detection and sequence analysis of porcine circovirus type 3 in sow sera from farms with prolonged histories of reproductive problems in Hunan, China. Arch Virol 2018, 163, 2841–2847. doi: 10.1007/s00705-018-3914-7.

If the inline PDF is not rendering correctly, you can download the PDF file here.

  • 1

    Collins P.J., McKillen J., Allan G.: Porcine circovirus type 3 in the UK. Vet Rec 2017, 181, 599. doi: 10.1136/vr.j5505.

  • 2

    Dee S.A., Bauermann F.V., Niederwerder M.C., Singrey A., Clement T., de Lima M., Long C., Patterson G., Sheahan M.A., Stoian A.M.M., Petrovan V., Jones C.K., De Jong J., Ji J., Spronk G.D., Minion L., Christopher-Hennings J., Zimmerman J.J., Rowland R.R.R., Nelson E., Sundberg P., Diel D.G.: Survival of viral pathogens in animal feed ingredients under transboundary shipping models. PLoS One 2018, 13, e0194509. doi: 10.1371/journal.pone.0194509.

  • 3

    Deng J., Li X., Zheng D., Wang Y., Chen L., Song H., Wang T., Huang Y., Pang W., Tian K.: Establishment and application of an indirect ELISA for porcine circovirus 3. Arch Virol 2018, 163, 479–482. doi: 10.1007/s00705-017-3607-7.

  • 4

    Faccini S., Barbieri I., Gilioli A., Sala G., Gibelli L.R., Moreno A., Sacchi C., Rosignoli C., Franzini G., Nigrelli A.: Detection and genetic characterization of Porcine circovirus type 3 in Italy. Transbound Emerg Dis 2017, 64, 1661–1664. doi: 10.1111/tbed.12714.

  • 5

    Franzo G., Legnardi M., Tucciarone C.M., Drigo M., Klaumann F., Sohrmann M., Segalés J.: Porcine circovirus type 3: a threat to the pig industry? Vet Rec 2018, 182, 83. doi: 10.1136/vr.k91.

  • 6

    Fux R., Söckler C., Link E.K., Renken C., Krejci R., Sutter G., Ritzmann M., Eddicks M.: Full genome characterization of porcine circovirus type 3 isolates reveals the existence of two distinct groups of virus strains. Virol J 2018, 15, 25. doi: 10.1186/s12985-018-0929-3.

  • 7

    Ha Z., Xie C.Z., Li J.F., Wen S.B., Zhang K.L., Nan F.L., Zhang H., Guo Y.C., Wang W., Lu H.J., Jin N.Y.: Molecular detection and genomic characterization of porcine circovirus 3 in pigs from Northeast China. BMC Vet Res 2018, 14, 321. doi: 10.1186/s12917-018-1634-6.

  • 8

    Hayashi S., Ohshima Y., Furuya Y., Nagao A., Oroku K., Tsutsumi N., Sasakawa C., Sato T.: First detection of porcine circovirus type 3 in Japan. J Vet Med Sci 2018, 80, 1468–1472. doi: 10.1292/jvms.18-0079.

  • 9

    Kedkovid R., Woonwong Y., Arunorat J., Sirisereewan C., Sangpratum N., Kesdangsakonwut S., Tummaruk P., Teankum K., Assavacheep P., Jittimanee S., Thanawongnuwech R.: Porcine circovirus type 3 (PCV3) shedding in sow colostrum. Vet Microbiol 2018, 220, 12–17. doi: 10.1016/j.vetmic.2018.04.032.

  • 10

    Kedkovid R., Woonwong Y., Arunorat J., Sirisereewan C., Sangpratum N., Lumyai M., Kesdangsakonwut S., Teankum K., Jittimanee S., Thanawongnuwech R.: Porcine circovirus type 3 (PCV3) infection in grower pigs from a Thai farm suffering from porcine respiratory disease complex (PRDC). Vet Microbiol 2018, 215, 71–76. doi: 10.1016/j.vetmic.2018.01.004.

  • 11

    Kim S.C., Nazki S., Kwon S., Juhng J.H., Mun K.H., Jeon D.Y., Jeong C.G., Khatun A., Kang S.J., Kim W.I.: The prevalence and genetic characteristics of porcine circovirus type 2 and 3 in Korea. BMC Vet Res 2018, 14, 294. doi: 10.1186/s12917-018-1614-x.

  • 12

    Kim S.H., Park J.Y., Jung J.Y., Kim H.Y., Park Y.R., Lee K.K., Lyoo Y.S., Yeo S.G., Park C.K.: Detection and genetic characterization of porcine circovirus 3 from aborted fetuses and pigs with respiratory disease in Korea. J Vet Sci 2018, 19, 721–724. doi: 10.4142/jvs.2018.19.5.721.

  • 13

    Klaumann F., Correa-Fiz F., Franzo G., Sibila M., Núñez J.I., Segalés J.: Current knowledge on porcine circovirus 3 (PCV-3): A novel virus with a yet unknown impact on the swine industry. Front Vet Sci 2018, 5, 315. doi: 10.3389/fvets.2018.00315.

  • 14

    Klaumann F., Dias-Alves A., Cabezón O., Mentaberre G., Castillo-Contreras R., López-Béjar M., Casas-Díaz E., Sibila M., Correa-Fiz F., Segalés J.: Porcine circovirus 3 is highly prevalent in serum and tissues and may persistently infect wild boar Sus scrofa scrofa Transbound Emerg Dis 2019, 66, 91–101. doi: 10.1111/tbed.12988.

  • 15

    Klaumann F., Franzo G., Sohrmann M., Correa-Fiz F., Drigo M., Núñez J.I., Sibila M., Segalés J.: Retrospective detection of Porcine circovirus 3 (PCV-3) in pig serum samples from Spain. Transbound Emerg Dis 2018, 65, 1290–1296. doi: 10.1111/tbed.12876.

  • 16

    Li G., He W., Zhu H., Bi Y., Wang R., Xing G., Zhang C., Zhou J., Yuen K.Y., Gao G.F., Su S.: Origin, genetic diversity, and evolutionary dynamics of novel porcine circovirus 3. Adv Sci (Weinh) 2018, 5, 1800275. doi: 10.1002/advs.201800275.

  • 17

    Li G., Wang H., Wang S., Xing G., Zhang C., Zhang W., Liu J., Zhang J., Su S., Zhou J.: Insights into the genetic and host adaptability of emerging porcine circovirus 3. Virulence 2018, 9, 1301–1313. doi: 10.1080/21505594.2018.1492863.

  • 18

    Li X., Zhang C., Qiao M., Guo J., Xing G., Jin C., Wang J., Sun M., Tian K.: Molecular epidemiology of porcine circovirus type 3 infection in swine herds in China. Virol Sin 2018, 9. doi: 10.1007/s12250-018-0041-2.

  • 19

    Lu B., Qin Y., He Y., Liu L., Duan Q., Zhou Y., Li B., Chen Z., Liang J., Su Q., Bi B., Jiang D., Lu J., Zhao W.: Complete genome sequence of a novel porcine circovirus type 3 strain, CH/GX/1776D/2017, isolated from Guangxi, China. Genome Announc 2018, 6. pii: e00285–18. doi: 10.1128/genomeA. 00285-18.

  • 20

    Palinski R., Piñeyro P., Shang P., Yuan F., Guo R., Fang Y., Byers E., Hause B.M.: A novel porcine circovirus distantly related to known circoviruses is associated with porcine dermatitis and nephropathy syndrome and reproductive failure. J Virol 2016, 91. pii: e01879–16. doi: 10.1128/JVI.01879-16.

  • 21

    Phan T.G., Giannitti F., Rossow S., Marthaler D., Knutson T.P., Li L., Deng X., Resende T., Vannucci F., Delwart E.: Detection of a novel circovirus PCV3 in pigs with cardiac and multisystemic inflammation. Virol J 2016, 13, 184. doi: 10.1186/s12985-016-0642-z.

  • 22

    Saraiva G.L., Vidigal P.M.P., Fietto J.L.R., Bressan G.C., Silva Júnior A., de Almeida M.R.: Evolutionary analysis of porcine circovirus 3 (PCV3) indicates an ancient origin for its current strains and a worldwide dispersion. Virus Genes 2018, 54, 376–384. doi: 10.1007/s11262-018-1545-4.

  • 23

    Stadejek T., Woźniak A., Miłek D., Biernacka K.: First detection of porcine circovirus type 3 on commercial pig farms in Poland. Transbound Emerg Dis 2017, 64, 1350–1353. doi: 10.1111/tbed.12672.

  • 24

    Sun J., Wei L., Lu Z., Mi S., Bao F., Guo H., Tu C., Zhu Y., Gong W.: Retrospective study of porcine circovirus 3 infection in China. Transbound Emerg Dis 2018, 65, 607–613. doi: 10.1111/tbed.12853.

  • 25

    Tochetto C., Lima D.A., Varela A.P.M., Loiko M.R., Paim W.P., Scheffer C.M., Herpich J.I., Cerva C., Schmitd C., Cibulski S.P., Santos A.C., Mayer F.Q., Roehe .P.M.: Full-genome sequence of porcine circovirus type 3 recovered from serum of sows with stillbirths in Brazil. Transbound Emerg Dis 2018, 65, 5–9. doi: 10.1111/tbed.12735.

  • 26

    Wen S., Sun W., Li Z., Zhuang X., Zhao G., Xie C., Zheng M., Jing J., Xiao P., Wang M., Han J., Ren J., Liu H., Lu H., Jin N.: The detection of porcine circovirus 3 in Guangxi, China. Transbound Emerg Dis 2018, 65, 27–31. doi: 10.1111/tbed.12754.

  • 27

    Xu P.L., Zhang Y., Zhao Y., Zheng H.H., Han H.Y., Zhang H.X., Chen H.Y., Yang M.F., Zheng L.L.: Detection and phylogenetic analysis of porcine circovirus type 3 in central China. Transbound Emerg Dis 2018, 65, 1163–1169. doi: 10.1111/tbed.12920.

  • 28

    Ye X., Berg M., Fossum C., Wallgren P., Blomström A.L.: Detection and genetic characterisation of porcine circovirus 3 from pigs in Sweden. Virus Genes 2018, 54, 466–469. doi: 10.1007/s11262-018-1553-4.

  • 29

    Yuzhakov A.G., Raev S.A., Alekseev K.P., Grebennikova T.V., Verkhovsky O.A., Zaberezhny A.D., Aliper T.I.: First detection and full genome sequence of porcine circovirus type 3 in Russia. Virus Genes 2018, 54, 608–611. doi: 10.1007/s11262-018-1582-z.

  • 30

    Zhai S.L., Chen S.N., Xu Z.H., Tang M.H., Wang F.G., Li X.J., Sun B.B., Deng S.F., Hu J., Lv D.H., Wen X.H., Yuan J., Luo M.L., Wei W.K.: Porcine circovirus type 2 in China: an update on and insights to its prevalence and control. Virol J 2014, 11, 88. doi: 10.1186/1743-422X-11-88.

  • 31

    Zhai S.L., Zhou X., Zhang H., Hause B.M., Lin T., Liu R., Chen Q.L., Wei W.K., Lv D.H., Wen X.H., Li F., Wang D.: Comparative epidemiology of porcine circovirus type 3 in pigs with different clinical presentations. Virol J 2017, 14, 222. doi: 10.1186/s12985-017-0892-4.

  • 32

    Zheng S., Shi J., Wu X., Peng Z., Xin C., Zhang L., Liu Y., Gao M., Xu S., Han H., Yu J., Sun W., Cong X., Li J., Wang J.: Presence of Torque teno sus virus 1 and 2 in porcine circovirus 3-positive pigs. Transbound Emerg Dis 2018, 65, 327–330. doi: 10.1111/tbed.12792.

  • 33

    Zou Y., Zhang N., Zhang J., Zhang S., Jiang Y., Wang D., Tan Q., Yang Y., Wang N.: Molecular detection and sequence analysis of porcine circovirus type 3 in sow sera from farms with prolonged histories of reproductive problems in Hunan, China. Arch Virol 2018, 163, 2841–2847. doi: 10.1007/s00705-018-3914-7.

Journal + Issues

Search

  • View in gallery

    A – geographic distribution of sampled farms, B – positive rates of PCV3 infection in different commercial pig farms in Xinjiang province, China

    Note: Positive rate was determined based on PCR analysis of clinical samples.

  • View in gallery

    Phylogenetic analysis of PCV3 strains based on the full-length cap gene using the neighbour-joining method

    Note: The nucleotide sequences of cap gene of PCV3 strains obtained in this study and available in GenBank were used to construct a phylogenetic tree by the neighbour-joining method. Bootstrap values were calculated with 1,000 replicates. Vertical lines are used to indicate groups (or subgroups) which were referred to in the text. Filled circles indicate the PCV3 strains identified in this study