Wykrywanie mutacji w genie CALR oraz w genie ASXL1 u chorych na nadpłytkowość samoistną i samoistne włóknienie szpiku przy pomocy sekwencjonowania Sangera oraz analizy długości fragmentów DNA

Open access

Streszczenie

Mutacje w eksonie 9 genu CALR oraz w eksonie 13 genu ASXL1 należą do markerów molekularnych o znaczeniu diagnostycznym i rokowniczym u chorych na nadpłytkowość samoistną (essential thrombocythemia – ET) oraz samoistne włóknienie szpiku (myelofibrosis – MF). Celem pracy było opracowanie i wdrożenie metod wykrywania mutacji w obu genach przy użyciu techniki sekwencjonowania Sangera oraz analizy długości fragmentów DNA. Przebadano 20 chorych na ET oraz 20 na MF. Sekwencjonowanie Sangera stosowano w wykrywaniu mutacji w obu genach, a analizę długości fragmentów DNA w wykrywaniu mutacji genu CALR. Typ 1 mutacji w genie CALR wykryto u 67% chorych na ET i u 86% chorych na MF, typ 2 mutacji potwierdzono u 15% ET i MF. Czułość diagnostyczna analizy długości fragmentów DNA wynosiła 3% obciążenia nieprawidłowym allelem, przy dolnej granicy detekcji 7-10% dla sekwencjonowania Sangera. Mutacje eksonu 13 genu ASXL1 wykryto u 25% chorych na MF (czułość 25%). Uzyskane wyniki wskazują na duże zalety praktyczne analizy długości fragmentów DNA jako techniki przesiewowej w diagnostyce ET oraz MF. Jej zastosowanie wraz z konwencjonalnym sekwencjonowaniem pozwala na wiarygodne wykrywanie i identyfikację aberracji genu CALR. Jednoczesna analiza mutacji somatycznych w genach CALR oraz ASXL1 ułatwia diagnostykę różnicową chorych na MPN Ph- i służy stratyfikacji ryzyka w ich przebiegu.

Streszczenie

Mutacje w eksonie 9 genu CALR oraz w eksonie 13 genu ASXL1 należą do markerów molekularnych o znaczeniu diagnostycznym i rokowniczym u chorych na nadpłytkowość samoistną (essential thrombocythemia – ET) oraz samoistne włóknienie szpiku (myelofibrosis – MF). Celem pracy było opracowanie i wdrożenie metod wykrywania mutacji w obu genach przy użyciu techniki sekwencjonowania Sangera oraz analizy długości fragmentów DNA. Przebadano 20 chorych na ET oraz 20 na MF. Sekwencjonowanie Sangera stosowano w wykrywaniu mutacji w obu genach, a analizę długości fragmentów DNA w wykrywaniu mutacji genu CALR. Typ 1 mutacji w genie CALR wykryto u 67% chorych na ET i u 86% chorych na MF, typ 2 mutacji potwierdzono u 15% ET i MF. Czułość diagnostyczna analizy długości fragmentów DNA wynosiła 3% obciążenia nieprawidłowym allelem, przy dolnej granicy detekcji 7-10% dla sekwencjonowania Sangera. Mutacje eksonu 13 genu ASXL1 wykryto u 25% chorych na MF (czułość 25%). Uzyskane wyniki wskazują na duże zalety praktyczne analizy długości fragmentów DNA jako techniki przesiewowej w diagnostyce ET oraz MF. Jej zastosowanie wraz z konwencjonalnym sekwencjonowaniem pozwala na wiarygodne wykrywanie i identyfikację aberracji genu CALR. Jednoczesna analiza mutacji somatycznych w genach CALR oraz ASXL1 ułatwia diagnostykę różnicową chorych na MPN Ph- i służy stratyfikacji ryzyka w ich przebiegu.

Wstęp

Nowotwory mieloproliferacyjne bez chromosomu Filadelfia (mieloproliferative neoplasms Philadelphia-negative – MPN Ph-) to grupa chorób układu krwiotwórczego wywodzących się ze zmienionej genetycznie hematopoetycznej komórki macierzystej (hematopoietic stem cell – HSC), której cechą jest nadmierna i autonomiczna proliferacja [1]. Do MPN Ph- zaliczana jest między innymi czerwienica prawdziwa (polycythemia rubra vera – PV), nadpłytkowość samoistna (essential thrombocythemia – ET) oraz samoistne włóknienie szpiku (myelofibrosis – MF), które może być pierwotne lub wtórne do PV albo do ET (primary myelofibrosis – PMF, post-PV MF, post-ET MF). Do 2016 roku wśród głównych kryteriów klasyfikacji MPN Ph-Światowej Organizacji Zdrowia (World Health Organization – WHO) uwzględniano wykrycie mutacji JAK2V617F, mutacji w eksonie 12 tego genu oraz mutacji w eksonie 10 genu receptora trombopoetynowego (myeloproliferative leukemia virus oncogene – MPL) [2], następnie uwzględniono mutacje w genie CALR [3]. W 2013 roku po raz pierwszy wykryto mutacje somatyczne w genie kalretikuliny (carleticulin CALR) [4, 5]. Lokalizują się one w eksonie 9 tego genu i w 80-90% polegają na insercjach lub delecjach [4, 5]. Wyróżnia się ponad 50 wariantów zmutowanego genu CALR, wśród których najczęstsze to delecja 52-bp (typ 1 mutacji) i insercja 5-bp (typ 2 mutacji) [4, 7]. Kalretikulina to wysoce konserwatywne, wielofunkcyjne białko, odpowiedzialne m.in. za wiązanie jonów wapnia w świetle retikulum endoplazmatycznego (ER), gdzie pełni funkcję białka opiekuńczego uczestniczącego w prawidłowym fałdowaniu glikoprotein [8]. Mutacja powoduje utratę sekwencji sygnałowej KDEL w C-końcowym fragmencie białka i zastąpienie jej inną sekwencją aminokwasową, co uniemożliwia retencję kalretikuliny w obrębie ER. Zmutowana forma białka CALR, działając za pośrednictwem receptora trombopoetyny, wywołuje stałą, konstytutywną aktywację szlaku sygnałowego JAK‑STAT [9, 10], który odgrywa kluczową rolę w patogenezie MPN Ph- [9, 10], pośrednicząc w regulacji proliferacji, różnicowania i przetrwania komórek krwiotwórczych [11]. Wykrycie mutacji w genie CALR wiąże się z wydłużeniem przeżycia u chorych na MF [12] i zostało uznane za korzystny czynnik rokowniczy przydatny wraz z oceną innych zmian molekularnych w stratyfikacji ryzyka przebiegu tej choroby [13]. MPN Ph- charakteryzuje obecność wielu mutacji rozproszonych w obrębie genów kodujących białka spliceosomu, białka odpowiedzialne za regulację stresu oksydacyjnego oraz regulujące mechanizmy epigenetyczne [10, 14, 15]. Powyższe aberracje genetyczne wpływają na fenotyp choroby i modyfikują jej kliniczny przebieg [16]. Obecność przynajmniej jednej z poniższych mutacji: ASXL1, TET2, DNMT3A, EZH2, SRSF2, IDH1/2, IKZF1, TP53 warunkuje wysokie ryzyko molekularne (high molecular risk – HMR), które wiąże się ze skróconym czasem przeżycia oraz ze zwiększonym ryzykiem transformacji białaczkowej [17, 18]. Ich wykrycie może być argumentem za przeprowadzeniem allogenicznej transplantacji komórek hemopoetycznych (haemopoietic stem cell transplantation – HSCT). W przebiegu MF najczęściej obserwowane jest współwystępowanie 2 lub większej liczby mutacji [19]. Jednym z głównych kryteriów rozpoznania MF według klasyfikacji WHO jest wykrycie mutacji w genie ASXL1 (additional sex comb like 1) jako istotnego markera klonalnego wzrostu komórek nowotworowych [3]. Czynne białko ASXL1 bierze udział w regulacji procesów epigenetycznych oraz w regulacji transkrypcji poprzez oddziaływanie z kompleksem białek PRC (polycomb repressive complex) oraz licznymi aktywatorami transkrypcji [20]. Mutacje somatyczne w eksonie 13 genu ASXL1 prowadzą do przesunięcia ramki odczytu lub powstania kodonu „Stop”, co skutkuje utratą końcowej domeny karboksylowej PDH (plant homeodomain) i w konsekwencji utratą prawidłowej funkcji białka [14, 21].

W oparciu o profil zmian molekularnych, niezależnie od dotychczas stosowanych wskaźników oceniających parametry kliniczno‑ laboratoryjne, jak Międzynarodowy Wskaźnik Prognostyczny (International Prognostic Scoring System – IPSS) lub Dynamiczny Międzynarodowy Wskaźnik Prognostyczny (Dynamic International Prognostic Scoring System – DIPSS), opracowano model prognostyczny przydatny w identyfikacji choroby gorszego rokowania [13]. Bazuje on na wykryciu przynajmniej jednej aberracji współtowarzyszącej mutacjom tzw. wiodącym (driver mutations), jak: JAK2, CALR, MPN [22, 23]. Szczególne znaczenie prognostyczne dla przebiegu MF ma ocena współwystępowania mutacji w genie CALR z mutacją w genie ASXL1. Obecność obu mutacji charakteryzuje grupę chorych o pośrednim czasie przeżycia, dłuższym niż u osób ASXL1+ i CALR-, i krótszym niż u chorych ASXL1- i CALR+ [18, 24]. Pogłębiona diagnostyka molekularna nowotworów mieloproliferacyjnych powinna obejmować testy wykrywające wspomniane powyżej mutacje, gdyż poza swoją wartością diagnostyczną umożliwiają one lepszą stratyfikację ryzyka w ich przebiegu i dobranie optymalnego sposobu leczenia dla poszczególnych chorych.

Celem niniejszej pracy było opracowanie i wdrożenie metod wykrywania mutacji w genie CALR oraz w genie ASXL1 przy użyciu techniki sekwencjonowania Sangera oraz analizy długości fragmentów DNA u chorych na ET oraz MF.

Materiał i metody

Grupę badanych stanowiło 40 chorych (21 kobiet i 19 mężczyzn) w wieku 20-82 lata (mediana wieku w chwili rozpoznania wynosiła 56 lat) z rozpoznanym MPN Ph-, zdiagnozowanych w Katedrze i Klinice Hematologii Szpitala Uniwersyteckiego w Krakowie od początku stycznia 2012 do końca grudnia 2015 roku. Rozpoznanie danej jednostki chorobowej dokonano w oparciu o klasyfikację WHO z 2008 roku [3]. Badania wykonano po uprzednim uzyskaniu zgody Komisji Bioetycznej Collegium Medicum Uniwersytetu Jagiellońskiego, z poszanowaniem zasad Deklaracji Helsińskiej. Część doświadczalną przeprowadzono w Pracowni Diagnostyki Molekularnej Zakładu Diagnostyki Hematologicznej Szpitala Uniwersyteckiego w Krakowie przy współpracy z Pracownią Badań Genetycznych Katedry i Kliniki Endokrynologii Szpitala Uniwersyteckiego w Krakowie oraz Zakładem Diagnostyki Genetycznej i Nutrigenomiki z Katedry Biochemii Klinicznej Uniwersytetu Jagiellońskiego Collegium Medicum. Badania w kierunku mutacji w genie CALR wykonano u 20 chorych na ET oraz 20 na MF. Analizę obecności mutacji w genie ASXL1 przeprowadzono u 20 chorych na MF. Do oceny obecności mutacji w genie CALR oraz ASXL1 pobierano krew obwodową z żyły łokciowej na EDTA w proporcji 9:1. Następnie izolowano komórki jądrzaste, przeprowadzając lizę erytrocytów za pomocą chlorku amonu (NH Cl). Izolację genomowego DNA z pozyskanych komórek przeprowadzono, wykorzystując zestaw kolumienkowy do izolacji DNA (MACHEREY‑NAGEL GmbH), zgodnie z instrukcją podaną przez producenta. Oceny stężenia uzyskanego DNA dokonywano na podstawie pomiaru spektrofotometrycznego (Thermo Fisher Scientific) przy długości fali 260 nm, jednocześnie oceniając czystość preparatu na podstawie stosunku absorbancji A260nm/A280nm.

Wykrywanie obecności mutacji genu CALR w eksonie 9 metodą analizy długości fragmentów DNA

W celu określenia typu mutacji w pierwszej kolejności DNA wyizolowane z 40 próbek poddano łańcuchowej reakcji polimerazy (polymerase chain reaction – PCR) z odpowiednim zestawem starterów dedykowanych do analizy długości fragmentów DNA zaprojektowanych w sposób pozwalający na ocenę eksonu 9 genu CALR (Tab. I) [4]. Amplifikację prowadzono zgodnie z profilem temperaturowym reakcji PCR: 95°C, 10 min – 10 x (94°C, 15 s– 55°C, 15 s– 72°C, 30 s) – 20 x (89°C, 15 s– 55°C, 15 s – 72°C, 30 s) – 72°C, 20 min. Końcowa objętość mieszaniny reakcyjnej wynosiła 25 μl: 12,5 μl – Ampli Taq Gold 360 Master Mix plus, 2,5 μl – GC Enhancer (Thermo Fisher Scientific), 1 μl – każdego startera o wyjściowym stężeniu 10 μM. Reakcję przeprowadzono z 100 ng DNA. Uzyskany znakowany fluorescencyjnie produkt PCR reakcji amplifikacji rozcieńczono w stosunku 1:9, a następnie 0,25 μl zmieszano z 24,3 μl formamidu (Hi-Di Formamide, Applied Biosystems). Do mieszaniny reakcyjnej dodano standard wielkości GeneScan 500 LIZ Size (Applied Biosystems), składający się z kilkunastu wyznakowanych fluorescencyjnie fragmentów DNA o znanej długości, podlegających rozdziałowi razem z próbką. Standard wielkości wykorzystano do określenia długości analizowanego fragmentu genu CARL na podstawie krzywej standardowej wykreślanej automatycznie przez oprogramowanie (Peak Scanner Software v1.0, Applied Biosystems). Uzyskaną mieszaninę reakcyjną poddano cieplnej denaturacji (95°C przez 5 minut) w termocyklerze Mastercycler nexus (Eppendorf). Kolejno przeprowadzono rozdział elektroforetyczny w 16-kapilarnym sekwenatorze 3130xl (Applied Biosystems). Elektroforeza została przeprowadzona w temperaturze 60°C z użyciem denaturującego żelu poliakrylamidowego POP7 (POP-7 Polymer, Applied Biosystems) oraz kapilary o długości 36 cm (3130xl Genetic Analyzer 16-Capillary Array, Applied Biosystems) przy wysokim napięciu 15 kV. Elektroiniekcja analizowanych produktów następowała przy napięciu 3 kV, natomiast całkowity czas trwania analizy wynosił 2100 sekund. Detekcja sygnału świetlnego emitowanego przez wyznakowane fluorescencyjne znaczniki użyte na etapie reakcji amplifikacji została przeprowadzona z użyciem filtru G5. Pliki z surowymi danymi pozyskano przy użyciu programu AB DNA Sequencing Analysis Software v. 5.2. (Applied Biosystems). Uzyskane dane surowe poddano analizie za pomocą oprogramowania Peak Scanner Software v1.0 (Applied Biosystems). Obecność mutacji typu delecji lub insercji potwierdzano w wynikach elektroforezy, odnosząc wykryte piki do piku pochodzącego od typu dzikiego z materiału uzyskanego od zdrowego dawcy (Ryc. 1).

Tabela I

Startery oligonukleotydowe wykorzystane do analizy mutacji w genie CALR (wg Klampf i wsp.) oraz genu ASXL1 (wg Gelsi-Boyer i wsp.) * analiza długości fragmentów, ** sekwencjonowanie Sangera

Table I. The list of primers were used for CALR (according to Klampf et al.) and ASXL1 mutations analysis (according to Gelsi‑Boyer et al.) * fragment analysis, ** Sanger sequencing

Analizowany genSekwencja nukleotydowa startera forward (5’-3’)Sekwencja nukleotydowa startera reverse (5’-3’)Wielkość amplikonu
CALR *FAM-GGCAAGGCCCTGAGGTGTGGCCTCAGTCCAGCCCTG265
CALR **ACAACTTCCTCATCACCAACGGGCCTCAGTCCAGCCCTG386
ASXL1(PCR1)AGGTCAGATCACCCAGTCAGTTTAGCCCATCTGTGAGTCCAACTGT561
ASXL1(PCR2)AGAGGACCTGCCTTCTCTGAGAAATTCGATGGGATGGGTATCCAATGC558
ASXL1(PCR3)ACTTGAAAACCAAGGCTCTCGTGCAACCATCCCATCTGTCCTTGTA532
ASXL1(PCR4)GGTGGACAAGGATGAGAAACCCAATGTCCTGTGACATAGCACGGACTT674
ASXL1(PCR5)TGGATTCCAAAGAGCAGTTCTCTTCCATGACAAAGGGCATCCCTTCCAA533
ASXL1(PCR6)ACAGGAAAGCTACTGGGCATAGTCCAAGAGTGCTCCTGCCTAAAGAGT593
Ryc. 1

Download Figure

Ryc. 1

Analiza obecności mutacji w genie CALR z zastosowaniem analizy długości fragmentów DNA (A-1, B-1) oraz sekwencjonowania Sangera (A-2, B-2). Delecja 52 par zasad (210 pz) obliczona w odniesieniu do dzikiego wariantu genu o wielkości 263 pz (A-1). Insercja 5 par zasad (268 pz) wskazana w odniesieniu do dzikiego wariantu genu (263 pz) (B-1)

Fig. 1. The presence of mutations in the CALR gene analyzed by PCR fragment analysis (A-1, B-1) and Sanger sequencing (A-2, B-2). The 52 base pair (210 pz) deletion calculated with reference to the wild variant gene (263 pz) (A-1). The 5 base pare insertion detected with reference to the wild variant gene (263 pz) (B-1)

Citation: Acta Haematologica Polonica 49, 3; 10.2478/ahp-2018-0020

Wykrywanie obecności mutacji genu CALR w eksonie 9 metodą Sangera

W celu potwierdzenia wyniku otrzymanego metodą analizy długości fragmentów, równocześnie dla wszystkich próbek przeprowadzono sekwencjonowanie DNA metodą Sangera. W pierwszej kolejności wykonano reakcję PCR z zastosowaniem zestawu starterów według Klampfl T. i wsp. [4] (Tab. I). W skład mieszaniny reakcyjnej wchodziło: 12,5 μl – AmpliTaq Gold 360 Master Mix oraz 2,5 μl – GC Enhancer (Thermo Fisher Scientific), 1,5 μl każdego startera o wyjściowym stężeniu 10 μM oraz 250 ng DNA. Końcowa objętość reakcyjna wynosiła 25 μl. Reakcja PCR przebiegała zgodnie z profilem temperaturowym („touch – down” PCR): 95°C, 5 min – 10 x (94°C, 30 s – 67°C, 30 s [-1°C na cykl] – 72°C, 30 s) – 29 x (94°C, 30 s – 57°C, 30 s – 72°C, 30 s) – 72°C, 10 min. Uzyskany produkt PCR oczyszczono przy użyciu zestawu kolumienkowego QIAquick PCR Purification Kit (Qiagen). Wydajność tego procesu weryfikowano w 2% żelu agarozowym. Następnie przeprowadzono sekwencjonowanie metodą Sangera będące reamplifikacją otrzymanego produktu z zastosowaniem tych samych starterów. Do PCR sekwencyjnego wykorzystano zestaw BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific Inc.) w objętości 1,25 μl, oraz 2 μl buforu v3.1 5X Sequencing Bufer (Thermo Fisher Scientific, Inc.), 0,16 μM startera forward lub reverse, 30 ng oczyszczonego DNA oraz dH 0 bez nukleaz (Ambion, Thermo Fisher Scientific, Inc.). Całkowita objętość reakcyjna wynosiła 10 μl. PCR sekwencyjny przeprowadzono w następujących warunkach: 96°C, 1 min – 25 x (96°C, 10 s – 50°C, 5 s – 60°C, 4 min) – 10°C chłodzenie. Produkt reakcji oczyszczono, wykorzystując metodę precypitacji etanolem w temperaturze pokojowej. Następnie dokonano rozdziału produktów na sekwenatorze kapilarnym ABI 3500 (Thermo Fisher Scientific) przy użyciu polimeru POP-7 (Thermo Fisher Scientific) i kapilar o długości 50 cm (Thermo Fisher Scientific). Otrzymane elektroforegramy porównano z sekwencją referencyjną kodującego DNA: NM_004343.3 (NCBI RefSeq) w odniesieniu do sekwencji referencyjnej LRG_828 (Locus Reference Genomic). Analizę sekwencji przeprowadzono z użyciem programu FinchTV v1.4 (Geospiza).

Wykrywanie obecności mutacji genu ASXL1 w eksonie 13 metodą Sangera

W pierwszym etapie wykonano reakcję PCR z użyciem 6 oddzielnych zestawów starterów, reakcje te zapewniły powielenie całego eksonu 13 genu ASXL1 [20] (Tab. I). Amplifikację prowadzono zgodnie z profilem temperaturowym reakcji PCR: 95°C, 2 min – 35 x (95°C, 30 s – 55°C, 1 min – 72°C, 1 min) – 72°C, 10 min. Końcowa objętość mieszaniny reakcyjnej wynosiła 25 μl: 5 μl – 5X Flexi Bufer (Promega), 7,5 μl – 2,5 mM dNTP, 4 μl – 25 mM MgCl2, 2 μl – 10 μM starter forward i reverse, 1,25 U – GoTaq G2 Hot Start Polymerase (Promega). Reakcję przeprowadzono z 40 ng DNA. Kolejne etapy: oczyszczanie produktu PCR, reakcja PCR sekwencyjny oraz rozdział produktu na sekwenatorze wykonano analogicznie jak w przypadku analizy mutacji w genie CALR.

Wszystkie otrzymane sekwencje przeanalizowano w porównaniu z sekwencją referencyjną kodującego DNA: NM_015338.5 (NCBI RefSeq) zgodną z sekwencją referencyjną LRG_630 (Locus Reference Genomic) pod kątem obecności mutacji w eksonie 13 genu ASXL1. Weryfikację obecności mutacji przeprowadzono z wykorzystaniem programu SeqScape Software v2.7 (Thermo Fisher Scientific). Dodatkowo każdą z sekwencji analizowano manualnie przy użyciu programu FinchTV (Geospiza).

Zgodnie z wytycznymi Human Genome Variation Society (HGVS) z 2016 roku wykryte mutacje opisano w notacji nukleotydowej oraz aminokwasowej, wskazując rodzaj oraz miejsce występowania aberracji na poziomie DNA oraz białka. W niniejszej pracy delecja 52 par zasad (typ 1 mutacji CALR) została opisana jako c.1099_1150del zgodnie z zasadą HGVS: najbliżej końca 3’ możliwa pozycja jest arbitralnie przypisana do zmiany. Warto zauważyć, że w tym regionie eksonu 9 genu występują 2 powtarzalne układy nukleotydowe GCAGAGG. W związku z powyższym c.1099_1150 odpowiada zamianie nukleotydowej c.1092_1143, wcześniej scharakteryzowanej przez Klampfl T. i wsp. [4] oraz Nangalia J. i wsp. [5].

Wykryte warianty genetyczne analizowano zarówno z wykorzystaniem narzędzi udostępnionych w bazie danych Ensembl i UCSC, jak i w oparciu o katalog mutacji somatycznych COSMIC (Catalogue of Somatic Mutations in Cancer) oraz dane z metabazy NCBI (National Center for Biotechnology Information), w szczególności dbSNP (Database of Single Nucleotide Polomorphism) i ClinVar, oraz baz ExAC (Exome Aggregation Consortium) i 1000 Genomes.

Ocena czułości oznaczeń aberracji w obrębie genów CALR i ASXL1

W celu ustalenia czułości detekcji mutacji CALR w eksonie 9 metodą analizy długości fragmentów DNA oraz techniką sekwencjonowania Sangera wykonano wiele rozcieńczeń DNA genomowego o znanym procentowym udziale allela z mutacją c.1099_1150del (50%) oraz c.1154_1155insTTGTC (48%) w DNA zdrowego dawcy. Wyjściową wartość obciążenia zmutowanym allelem oszacowano w oparciu o wynik elektroforezy kapilarnej. Wiele rozcieńczeń charakteryzowały punkty: 25%, 20%, 15%, 10%, 7%, 5%, 3%, 0% (w przypadku sekwencjonowania stężenie 3% nie było analizowane). Ocenę czułości sekwencjonowania Sangera w przypadku eksonu 13 genu ASXL1 wykonano po seryjnym rozcieńczeniu DNA pozyskanego z linii komórkowej MEG-01, będącej homozygotą c.1934dupG (p.Gly646Trpfs12) oraz z komórek z potwierdzoną homozygotyczną zamianą c.3759T>C (p.Ser1253=). Wiele rozcieńczeń charakteryzowały punkty: 100%, 50%, 25%, 10%, 7%, 5%, 0%.

Wykrywanie obecności mutacji JAK2V617F

Ocenę mutacji JAK2V617F wykonano w oparciu o metodę ilościowego PCR (qPCR), zgodnie z protokołem Larsena [25].

Analiza statystyczna

W analizie statystycznej wykorzystano test U Manna-Whitneya z użyciem oprogramowania GraphPad w wersji 4.0 (La Jolla).

Wyniki

Wykrywanie mutacji w genie CALR

Przeprowadzone badania pozwoliły na wykrycie mutacji somatycznych w obrębie eksonu 9 genu CALR u 13 spośród 40 (32%) badanych pacjentów. Wszystkie wykryte mutacje związane były z delecją lub insercją fragmentu DNA i prowadziły do przesunięcia ramki odczytu o +1 lub +2 pary zasad w obrębie sekwencji kodującej. Typ 1 – delecji 52 par zasad [c.1099_1150del, (p.Leu367ThrfsTer46)] wykryto u 10 z 13 (77%) chorych. Typ 2 – insercji 5 par zasad [c.1154_1155insTTGTC, (p.Lys385AsnfsTer47)] potwierdzono u 2 spośród 13 (15%) pacjentów, w jednym przypadku wykryto mutację, klasyfikowaną jako podobną do typu 1 (tzw. „type 1-like”) – delecję 34 par zasad [c.1100_1133del, (p.Leu367ArgfsTer52)] (Tab. II). Wśród chorych na ET zmiany w eksonie 9 genu CALR wykryto u 6 spośród 20 (30%) pacjentów (typ 1 u 4, co stanowiło 67%). U chorych na MF nieprawidłowy wariant genu CALR wykryto u 7 z 20 (35%) (typ 1 u 6, co stanowiło 87%) chorych. W grupie chorych na ET lub MF bez mutacji JAK2V617F i bez aberracji genu MPL, mutację w eksonie 9 genu CALR wykryto u 12 spośród 14 (86%) badanych: u 5 z 7 (71%) chorych na ET i u wszystkich 7 chorych na MF. Grupę chorych na ET lub MF bez mutacji eksonu 9 genu CALR (27 osób) stanowiło 24 pacjentów z mutacją JAK2V617F, 2 chorych z mutacją w genie MPL i 2 pacjentów „potrójnie negatywnych” bez mutacji JAK2V617F, CALR, MPL (Ryc. 2). W przypadku 1 chorego na ET wykryto współistnienie mutacji typu 1 CALR i mutacji JAK2V617F. Nie stwierdzono istotnych statystycznie różnic median parametrów hematologicznych pomiędzy grupami pacjentów JAK2V617F+CALR-i JAK2V617F-CALR+ zarówno w grupie chorych na ET, jak i na MF. Charakterystyka kliniczna pacjentów została przedstawiona w tabeli III.

Tabela II

Wykryte zmiany w obrębie genu CALR w badanej grupie pacjentów. Regiony I, II i III przedstawiają ujemnie naładowane aminokwasy białka kalretikuliny. Kolorem czerwonym zaznaczono sekwencję sygnałową KDEL

Table II. The detected abberations in CALR gene in the patients study group. The stressed fragments of protein sequences (I, II and III) present three different, negatively charged amino acids regions of calreticulin. The signal sequence KDEL is marked in red

Fragment sekwencji referencyjnej białka NP_004334.1
Typ mutacjiZamiana nukleo-tydówZamiana białka na poziomieWariant sekwencji aminokwasowej białka
Typ 1c.1099_1150delp.(Leu367ThrfsTer46)
Typ 2c.1154_1155insp.(Lys385AsnfsTer47)
TTGTCCREACLQGWT EA*
Typ 1-podobnyc.1100_1133delp.(Leu367ArgfsTer52)
Ryc. 2

Download Figure

Ryc. 2

Rozkład mutacji w wybranych genach JAK2, CALR, MPL na przykładzie badanej grupy pacjentów chorych na ET oraz MF

Fig. 2. The distribution of mutation analysed in JAK2, CALR and MPL genes in the study grup of patients with ET or MF

Citation: Acta Haematologica Polonica 49, 3; 10.2478/ahp-2018-0020

Tabela III

Parametry kliniczne chorych na ET oraz MF w obrębie grup: z mutacją JAK2V617F (JAK2V617F+) lub z mutacją w genie CALR (CALR+)

Table III. Clinical parameters o+f patients with ET and MF within the groups: with JAK2V617F mutation (JAK2V617F+) or with mutations within the CALR gene (CALR+)

ETETMFMF
Charakterystyka klinicznaJAK2 V617F+CALR+JAK2 V617F+CALR+
(N = 12)(N = 6)(N = 12)(N = 7)
Wiek, w latach (zakres)48,0

(22-82)
37

(20-77)
67,5

(44-78)
62

(35-69)
Mediana hemoglobiny, g/dl (zakres)15,0

(11,4-16,1)
13,6

(12,7-14,0)
12,8

(8,2-16,0))
11,4

(8,6-13,5)
Mediana hematokrytu, % (zakres)43,7

(36-46,4)
40

(37,9-40,6)
36,9

(28-51)
35

(28-40)
Mediana RBC, M/μl (zakres)4,9

(3,5-5,7)
4,4

(3,6-4,6)
4,3

(2,7-5,9)
3,8

(2,7-4,7)
Mediana WBC, K/μl (zakres)7,1

(4,8-19,5)
8,2

(6,6-13,7)
9,2

(5,2-21,5)
9,3

(7,3-22,5)
Mediana PLT, K/μl (zakres)380

(160-893)
465,5

(350-751)
541

(304-1164)
548

(400-1200)

Wykrywanie mutacji w genie ASXL1

Mutację w eksonie 13 genu ASXL1 wykryto u 5 spośród 20 (25%) chorych na MF (w jednym przypadku wykryto współwystępowanie 2 odmiennych wariantów genu). Wśród wykrytych zmian stwierdzono delecję, insercję pojedynczej pary zasad oraz substytucje pojedynczego nukleotydu (Tab. IV).

Tabela IV

Wykryte warianty genu ASXL1 w grupie chorych na MF. BD – brak informacji o klinicznym znaczeniu wykrytej zmiany

Table IV. Variants of the ASXL1 gene detected in the group of patients with MF. BD – no data available regarding the clinical significance of the detected variant

Nr próbkiPłećWiekWykryta aberracja w eksonie 13 genu ASXL1 (wg HGVS)Rodzaj zmianyNr referencyjny w bazie COSMICNr referencyjny w bazie dbSNP (wg NCBI)MAF (frekwencja rzadszego allela wg ExAC)Znaczenie kliniczne mutacji opisane w bazie ClinVar (wg NCBI)Odniesienie w literaturzeWystępowanie CALR z ASXL1
1M69c.2302C>T

p.Gln768Ter
NonsensownaCOSM41717rs770762273T = 0,00001650BDGelsi-Boyer V i wsp. Br J Haematol 2009 ;145(6):788‑-800NIE
2K54c.3306G>T

p.Glu1102Asp
MissensowaCOSM36205rs139115934T= 0,01009Raczej łagodna(nietestowana klinicznie)Grossmann V i wsp. Leukemia 2011;25(5):877-9NIE
3M69c.1934dupG

p.Gly646TrpfsTer12

c.2957A>G

p.Asn986Ser
Przesunięcie ramki odczytu missensowaCOSM34210 COSM96383rs1085307856 rs145132837BD

G = 0,001261
Onkogenna raczej łagodna (nietestowana klinicznie)Carbuccia N i wsp. Leukemia 2009; 23(11):2183‑6. Thol F i wsp. J Clin Oncol 2011;29(18):2499‑506TAK
4K68c.2338C>T

p.Gln780Ter
NonsensownaCOSM1012910rs751021760T =0,000008262BDPapaemmanuil E i wsp. Blood 2013;122(22):3616-27TAK
5K51c.2113delG

p.Glu705SerfsTer20
Przesunięcie ramki odczytuCOSM1155825rs778670589BDBDGrossmann V i wsp. Leukemia 2011;25(5):877-9NIE

Nie odnotowano istotnych różnic pomiędzy parametrami klinicznymi i hematologicznymi w chwili rozpoznania u chorych na MF z mutacją w eksonie 13 genu ASXL1 oraz pacjentami z prawidłowym wariantem genu (Tab. V).

Tabela V

Parametry kliniczne chorych na MF w obrębie grup: z mutacją w genie ASXL1 (ASXL1+) oraz bez mutacji w genie ASXL1 (ASXL1-)

Table V. Clinical parameters of patients with MF in groups: with mutations in the ASXL1 gene (ASXL1+) and without mutations in the ASXL1 gene (ASXL1-)

Charakterystyka klinicznaMF

ASXL1+
MF

ASXL1
Wiek, w latach (zakres)62

(51-69)
62

(35-69)
Mediana hemoglobiny, g/dl (zakres)11,6

(10,8-14,6)
11,4

(10,4-13,5)
Mediana hematokrytu, % (zakres)35,9

(28-43,4)
35,2

(31-35,4)
Mediana RBC, M/μl (zakres)4,1

(3,4-5,5)
3,8

(2,7-4,7)
Mediana WBC, K/μl (zakres)7,9

(7,9-9,6)
9,7

(7,3-22,5)
Mediana PLT, K/μl (zakres)450

(304-590)
584,5

(400-1200)

U połowy z 20 chorych na MF wykryto układ mutacji CALRASXL1-, u 5 (25%) pacjentów układ CALR+ASXL1-, a u 3 (15%) chorych CALRASXL1+ (u 2 spośród 3 pacjentów stwierdzono współwystępowanie mutacji ASXL1 z mutacją JAK2V617F lub z mutacją w genie MPL). Jednoczesne występowanie mutacji ASXL1+CALR+ wykryto u 2 (10%) chorych.

Ocena czułości detekcji w teście analizy długości fragmentów została ustalona na poziomie 3% obciążenia zmutowanym allelem zarówno w przypadku typu 1 (Ryc. 3), jak i typu 2 mutacji CALR.

Ryc. 3

Download Figure

Ryc. 3

Ocena czułości wykrywania mutacji w eksonie 9 genu CALR w oparciu o seryjne rozcieńczenie DNA z wariantem c.1099_1150del52 w DNA zdrowego dawcy; analiza długości fragmentów DNA (A), sekwencjonowanie Sangera (B)

Fig. 3. Evaluation of method sensitivity for the detection of mutations within exon 9 of the CALR gene. Serial dilutions of DNA with the c.1099_1150del52 mutation in the DNA of a healthy donor were used for the study; fragment analysis (A), Sanger sequencing (B)

Citation: Acta Haematologica Polonica 49, 3; 10.2478/ahp-2018-0020

Czułość diagnostyczna sekwencjonowania Sangera wynosiła 7-10% zmutowanego allela [CALR typu 1 (Ryc. 3) i typu 2]. Czułość detekcji mutacji w eksonie 13 genu ASXL1 konwencjonalnym sekwencjonowaniem zdefiniowano na poziomie 25%, w przypadku zamiany c.1934dupG oraz na poziomie 10% w przypadku wariantu c.3759T>C (Ryc. 4).

Ryc. 4

Download Figure

Ryc. 4

Ocena czułości diagnostycznej sekwencjonowania Sangera w oparciu o seryjne rozcieńczenia DNA z potwierdzoną zmianą w genie ASXL1: c.1934dupG (p.Gly646Trpfs12) (A), c.3759T>C (p.Ser1253=) (B)

Fig. 4. Estimation of diagnostic sensitivity of Sanger sequencing with the use of DNA with confirmed ASXL1 variant gene: c. 1934dupG (p.Gly646Trpfs12) (A), c.3759T>C (p.Ser1253=) (B)

Citation: Acta Haematologica Polonica 49, 3; 10.2478/ahp-2018-0020

Dyskusja

Zaburzenia molekularne w eksonie 9 genu CALR zaliczane są do najważniejszych aberracji genetycznych warunkujących rozwój MPN Ph-, przyczyniających się do ewolucji klonu komórek kształtujących fenotyp typowy dla ET lub MF, które przebiegają bez wykrywalnej mutacji JAK2V617F oraz w genie MPL. Znaczenie kliniczne badanego markera molekularnego podkreśla częstość jego występowania w grupie chorych na ET lub MF, która szacowana jest w dostępnych danych literaturowych na około 50-88% chorych [4, 5, 12, 26, 27, 28], a w badanym materiale wyniosła 86%.

Wdrożenie metod molekularnych umożliwiających ocenę występowania mutacji w genie CALR pozwala na pogłębioną diagnostykę i dostarcza dodatkowych informacji u chorych na ET lub MF bez mutacji JAK2V617F i w genie MPL [4, 29]. Doniesienia literaturowe wskazują, iż wystąpienie zmian w genie CALR u chorych na ET koreluje z młodszym wiekiem pacjentów, płcią męską, zwiększoną liczbą płytek krwi, obniżoną liczbą leukocytów, niższym stężeniem hemoglobiny oraz mniejszym ryzykiem powikłań zakrzepowych w porównaniu z pacjentami z wykrywaną mutacją V617F w genie JAK2 [7, 12, 26]. Zaobserwowano, że występowanie powyższej mutacji w genie CALR w przebiegu MF wiąże się z młodszym wiekiem w chwili zachorowania, podwyższoną liczbą płytek krwi, obniżoną liczbą leukocytów, wyższym stężeniem hemoglobiny i mniejszą częstością występowania mutacji białek spliceosomu w porównaniu z chorymi ze stwierdzoną obecnością mutacji JAK2V617F [30]. W toku przeprowadzonych badań w grupie chorych na ET lub MF nie wykazano istotnych statystycznie różnic w rozkładzie parametrów hematologicznych pomiędzy podgrupami pacjentów JAK2V617F+CALR- i JAK2V617F-CALR+. Jest to prawdopodobnie spowodowane zbyt małą liczebnością grup pacjentów, u których wykryto mutacje w obrębie genu CALR. W przypadku 1 pacjenta odnotowano współwystępowanie mutacji CALR z mutacją JAK2V617F. Nieliczne dane potwierdzają możliwość współwystępowania obu mutacji z prezentacją niskiego obciążenia allelem z mutacją V617F [31, 32].

Mutacje identyfikowane w obrębie eksonu 9 genu CALR pojawiają się w różnych pozycjach nukleotydowych tego genu. Z tego powodu wymagane jest zastosowanie metod przesiewowych zapewniających szybką i dokładną analizę badanego fragmentu DNA. Analiza ta w sposób szczegółowy powinna uwzględniać zachodzącą zmienność wykrywanych aberracji z możliwością dokładnej ich charakterystyki i opisu. Warunki te spełnia zastosowana w pracy analiza długości fragmentów DNA [4, 7, 12], która dzięki wysokiej rozdzielczości (nawet w zakresie 1-3 par zasad) oraz możliwości wykrycia obciążenia nieprawidłowym allelem na poziomie do 5% może adekwatnie oceniać zmiany insercyjno-delecyjne [33, 34]. Stosowanie jej zalecane jest w rekomendacjach ekspertów działających w ramach SIE (Italian Society of Hematology) [29], a także w innych publikacjach [4, 5, 34, 35]. Wdrażając metodę do rutynowej diagnostyki molekularnej, istotne jest skorelowanie jej czułości analitycznej z możliwością wykrycia najbardziej prawdopodobnego obciążenia nieprawidłowym allelem, które cechuje badaną populację chorych. W przypadku mutacji w eksonie 9 genu CALR w chwili rozpoznania zwykle odnotowywane jest średnie obciążenie nieprawidłowym allelem na poziomie 40-50%, rzadko wynosi poniżej 10% [34, 35, 36]. Metoda diagnostyki przesiewowej dla powyższej mutacji powinna zatem osiągać czułość detekcji rzędu co najmniej 10-15% [21, 29]. W niniejszych badaniach granice detekcji metody analizy długości fragmentów DNA oszacowano na poziomie 3%, co potwierdza jej użyteczność diagnostyczną w tym kontekście. Metoda ta nie jest jednak przydatna do oceny zmian substytucyjnych, takich jak mutacje punktowe lub łagodne warianty genu i wymaga uzupełnienia o wynik konwencjonalnego sekwencjonowania. Główną wadą sekwencjonowania metodą Sangera jest jej niewielka czułość (10-25%) [34, 37]. W niniejszej pracy, dzięki otrzymaniu wysokiej jakości chromatogramów (wysoka rozdzielczość oraz niski poziom szumów tła) w oparciu o próbki standardowe czułość tej metody oszacowano na poziomie 7-10%. Uzyskany poziom czułości jest wyższy niż przyjęty standardowy konsensus dla metody sekwencjonowania Sangera, jednak w literaturze opisywane są przypadki osiągnięcia czułości tą metodą na poziomie nawet poniżej 7%, również w odniesieniu do oceny obciążeniem mutacjami w genie CALR [38]. Dokładny opis wykrytej aberracji umożliwia łatwą jej weryfikację oraz daje szanse skorelowania jej obecności z fenotypem choroby. Jest to szczególnie ważne w przypadku możliwości wystąpienia ponad 50 różnych wariantów zmian insercyjno-delecyjnych [9].

W przeprowadzonych badaniach odnotowano, że przeważającą większość wykrytych mutacji w genie CALR stanowią aberracje typu 1 i typu 2, z przewagą odsetka wykrywanego pierwszego wariantu, co jest zgodne z dotychczasowymi doniesieniami [4, 5, 39]. Dokonując rozróżnienia na typ 1 i typ 2 mutacji CALR, w licznych badaniach wykazano różnicę w ich wpływie na ostateczny fenotyp ET i MF [9, 26, 27]. Badania własne ujawniły tendencję do częstszego występowania typu 1 mutacji u chorych na MF. Sugeruje to powiązanie tego wariantu zaburzeń w obrębie eksonu 9 z procesem rozwoju włóknienia szpiku kostnego oraz wysokim ryzykiem transformacji ET w post-ET MF, co również było postulowane w innych doniesieniach [9]. Obecność drugiego wariantu mutacji u chorych na MF wiąże się z wyższym wskaźnikiem prognostycznym DIPSS-plus, częstszym występowaniem dodatkowych mutacji w genach EZH2 i IDH, a rzadszym dla białek spliceosomu, większą liczbą krwinek białych i wzrostem odsetka komórek blastycznych we krwi obwodowej. Obecność mutacji typu 1 koreluje natomiast z dłuższym czasem przeżycia w porównaniu z typem 2 mutacji [27, 40, 41, 42]. Odmienne obserwacje podaje natomiast Pietra D. i wsp., sugerując korzystne rokowanie w przypadku pacjentów obciążonych mutacją typu 2 w porównaniu z typem 1 [9]. Sprzeczność wyników dotyczących prognostycznego znaczenia wykrytej aberracji w genie CALR na fenotyp MF wciąż wymaga weryfikacji w oparciu o większą liczbę danych. W badanym materiale mutacje typu 2 wykryto u 2 chorych na MF, co nie pozwala na dokonanie porównania w tym zakresie.

U chorych na ET występowanie wariantu 2 mutacji genu CALR związane jest ze znacznym wzrostem liczby płytek krwi [26]. Powyższy typ zmiany koreluje także z czasem przeżycia wolnym od incydentów zakrzepowych, z wyraźnym zmniejszeniem ryzyka ich wystąpienia oraz z łagodniejszym przebiegiem klinicznym choroby [9]. Niewielka liczba chorych z powyższym typem mutacji w badanej grupie nie pozwoliła na analizy korelacji z obrazem i przebiegiem choroby. Alternatywną metodą oceny aberracji w eksonie 9 genu CALR jest wysokorozdzielcza analiza krzywych topnienia (high resolution melting – HRM) [43]. Wykonanie badania przesiewowego z wykorzystaniem HRM umożliwia wykrycie zarówno zmian insercyjno-delecyjnych, jak i mutacji punktowych z czułością detekcji do 3-5% zawartości nieprawidłowego allela [34, 35, 44]. Technika ta, podobnie jak analiza długości fragmentów DNA, wskazuje jedynie na obecność mutacji bez możliwości określenia jej rodzaju i wymaga potwierdzenia za pomocą konwencjonalnego sekwencjonowania. Dodatkowym ograniczeniem HRM są niekiedy obserwowane wyniki fałszywie dodatnie, trudne do zweryfikowania w oparciu o inne metody [34]. Obecnie dużym postępem w diagnostyce molekularnej nowotworów mieloproliferacyjnych jest możliwość zastosowania sekwencjonowania nowej generacji (next-generation sequencing – NGS). Umiejętne opracowanie analizy NGS skoncentrowanej jedynie na oznaczeniu aberracji w obrębie genu CALR może zapewnić limit wykrywalności sięgający 1,25% obciążenia nieprawidłowym allelem [34]. Jednak jak na razie duże koszty oraz czasochłonność tej metody stanowią wciąż istotne jej wady i ograniczają użyteczność tej techniki jako badania przesiewowego.

Wszystkie wspomniane wyżej metody diagnostyczne zapewniają efektywną analizę możliwych zmian w eksonie 9 genu CALR, lecz niekoniecznie osiągają czułość ≤ 1%, zalecaną dla metod molekularnych stosowanych w diagnostyce MPN, między innymi w celu monitorowania obecności niskiego udziału klonu komórek z poszukiwaną mutacją [45, 46]. Wskazuje to na istotność zastosowania molekularnych metod ilościowych, które w sposób jednoznaczny pozwalają śledzić zmiany w obciążeniu zmutowanym allelem w trakcie stosowanej terapii oraz pozwalają na jego skorelowanie z profilem klinicznym pacjenta. Odpowiednią do tego celu jest metoda ilościowej reakcji łańcuchowej polimerazy DNA (quantitative polimeraze chain reaction – qPCR) oraz kropelkowa reakcja ddPCR (droplet digital PCR). Jednak gdy mamy do czynienia ze zmiennym charakterem aberracji w obrębie analizowanego eksonu, opracowanie metody umożliwiającej ocenę niewielkiego obciążenia zmutowanym allelem jest szczególnym wyzwaniem. Ograniczenia qPCR i ddPCR w tej sytuacji wynikają z możliwości przeprowadzenia jednorazowej analizy w kierunku tylko jednego wariantu zmian [43, 47].

Śledzenie odpowiedzi molekularnej na stosowaną terapię wymaga użycia metod molekularnych umożliwiających ilościową ocenę mutacji CALR, z czułością < 1% [47], gwarantującą monitorowanie minimalnej choroby resztkowej (minimal residual disease – MRD) lub prognozowanie nawrotu choroby, szczególnie po autologicznym przeszczepieniu komórek macierzystych szpiku kostnego (post‑ASCT, post-autologous stem cell transplantation) [29, 36, 46, 48]. Opublikowane dotychczas wyniki badań wskazują na możliwość uzyskania odpowiedzi molekularnych u pacjentów z wykrywaną mutacją typu 1 i typu 2, leczonych interferonem alfa (IFN-α), niezależnie od wykrytego typu mutacji [47, 49]. Ponadto w nielicznych przypadkach odnotowano spadek poziomu zmutowanego allela w trakcie terapii z zastosowaniem ruksolitynibu (inhibitora kinazy JAK2) czy imetelstatu (inhibitora telomerazy) [50, 51, 52]. Bieżące doniesienia podkreślają wpływ dodatkowych aberracji genetycznych na powodzenie leczenia i sugerują, że obecność zmian na poziomie molekularnym w genach, takich jak ASXL1, utrudnia odpowiedź kliniczną na IFN-α czy ruksolitynib [49, 53]. Może to prowadzić do heterogennej odpowiedzi molekularnej, polegającej na spadku poziomu allela z mutacją w genie CALR z jednoczesną niezależną ewolucją klonalną komórek z mutacją ASXL1 w trakcie leczenia lub na braku odpowiedzi molekularnej, który może wskazywać na współwystępowanie zmutowanych genów CALR i ASXL1 w jednym klonie komórek [49]. Świadomość konsekwencji obecności poszczególnych mutacji oraz możliwość ich diagnozowania pozwala na podjęcie dalszych kroków terapeutycznych, łącznie z ustaleniem wskazań do allogenicznego przeszczepienia krwiotwórczych komórek macierzystych (allogenic hematopoietic stem cel transplantation – allo-HSCT) [13]. W nowotworach mieloproliferacyjnych, takich jak PV i ET, mutacja ASXL1 występuje u mniej niż 10% pacjentów. Częściej (u 40% chorych) wykrywana jest w przebiegu MF [54].

Odsetek nieprawidłowego wariantu genu ASXL1 jest także wyższy u chorych na post-PV lub post-ET MF, co sugeruje, że zmienione białko ASXL1 może odgrywać ważną rolę w progresji obu nowotworów [20]. W toku przeprowadzonych badań zmiany w eksonie 13 genu ASXL1 wykryto u znacznego odsetka (25%) chorych na MF. Wyniki te są zbieżne z uzyskanymi w badaniach obejmujących dużą grupę chorych z tym rozpoznaniem [13, 19, 21, 55, 56, 57]. Obecność somatycznej mutacji p.Gly646TrpfsTer12 predysponuje do rozwoju nowotworu mieloproliferacyjnego [58] i jest najczęściej odnotowywaną aberracją w MF [55, 56, 57, 59, 60]. W przypadku mutacji p.Gln768Ter, p.Gln780Ter oraz p.Glu705SerfsTer20 o nieustalonym profilu prognostycznym można domniemywać ich znaczenia w rozwoju mielofibrozy. Wszystkie 3 mutacje prowadzą do skrócenia sekwencji aminokwasowej, co sugeruje utratę prawidłowej funkcji białka ASXL1. Potencjalny efekt fenotypowy działania skróconego produktu białkowego został porównany z podobnymi, znanymi patogennymi wariantami [56, 61]. Dodatkowo wpływ powyższych wariantów genu ASXL1 zweryfikowano w bazie VarSome (The Human Genomic Variant Search Engine), w której przypisano omawianym wariantom znaczenie patogenne w genezie choroby. Odmienny charakter mają substytucje pojedynczego nukleotydu prowadzące do zmiany aminokwasu na inny o zbliżonych właściwościach, jak w przypadku mutacji p.Glu1102Asp oraz p.Asn986Ser. W następstwie tych zmian zostaje zachowana konserwatywna budowa białka ASXL1, a znaczenie kliniczne odnotowywanych aberracji w genie ASXL1 pozostaje nadal niejasne [20, 62, 63]. Są to zmiany w obrębie genu o prawdopodobnie łagodnym znaczeniu zdefiniowanym w bazie VarSome, dodatkowo nieliczne doniesienia opisują wyraźny związek skrócenia czasu przeżycia oraz transformacji w ostrą białaczkę szpikową, gdy pod uwagę brane są jedynie zmiany wiążące się z syntezą skróconej formy białka ASXL1 [62, 64]. Przeprowadzona analiza statystyczna nie wykazała różnic w charakterystyce klinicznej między pacjentami z nieprawidłowym oraz prawidłowym wariantem genu ASXL1, co jest zbieżne z wcześniejszymi doniesieniami [55, 59, 62]. Jednak interpretacja powyższej obserwacji powinna być ostrożna i brać pod uwagę niewielką grupę pacjentów uczestniczących w badaniu. Uzyskane wyniki zgodne są z wcześniejszymi obserwacjami dotyczącymi współwystępowania mutacji CALR i ASXL1 w grupie chorych na MF i wykazują zbliżony odsetek poszczególnych koegzystencji jak w dotychczasowych publikacjach [24]. Teferi i wsp. [24] opracowali model prognostyczny oparty na obecności mutacji CARL i ASXL1, który okazał się niezależny od wskaźnika DIPSS i szczególnie przydatny dla identyfikacji źle rokujących chorych na MF. Obecność mutacji w genie ASXL1 opisano jako niekorzystny czynnik rokowniczy w kontekście współwystępowania z czynnikiem korzystnie rokującym, którym są mutacje w genie CALR [18, 24]. Dodatkowo występowanie mutacji w genie ASXL1 przy nieobecności mutacji CALR jest najistotniejszym niekorzystnym czynnikiem rokowniczym całkowitego czasu przeżycia chorego na MF [18]. Z mutacjami w ASXL1 powiązane jest dodatkowo większe ryzyko transformacji białaczkowej, agresywny przebieg choroby oraz skrócenie czasu całkowitego przeżycia pacjentów [23, 62, 65, 66].

Metody HRM oraz analiza długości fragmentów DNA nie znalazły zastosowania w diagnostyce genu ASXL1 z powodu konieczności zbadania obszernego fragmentu eksonu 13, wielkości 2907 nukleotydów, cechującego się dużym zróżnicowaniem obecnych nieprawidłowości genetycznych. Dodatkowo istniejący 25% próg wykrywalności może nie zapewniać dostatecznej czułości wykrywania tej mutacji [29]. Możliwość wykrywania aberracji ASXL1 w nielicznych komórkach pojedynczego podklonu komórek nowotworowych zapewnia metoda NGS. Obecnie jest ona jedyną metodą usprawniającą ocenę aberracji w genie ASXL1, pozwalającą na szybką molekularną diagnostykę różnorodnych mutacji somatycznych w pojedynczej próbce [29, 67] i z pewnością stanie się metodą stosowaną rutynowo. Opracowana i zastosowana w toku prezentowanych badań analiza długości fragmentów DNA dzięki, między innymi, dużej czułości diagnostycznej wykazała duże zalety praktyczne jako technika przesiewowa w diagnostyce ET oraz MF. Jej wykonanie wraz z uzupełniającym sekwencjonowaniem konwencjonalnym pozwala na wiarygodne wykrywanie i identyfikację zmian w obrębie eksonu 9 genu CALR. Opracowana i wdrożona metoda sekwencjonowania Sangera umożliwiła wykrycie i scharakteryzowanie mutacji w eksonie 13 genu ASXL1. Diagnostyka molekularna mutacji somatycznych w obu badanych genach daje możliwość stratyfikacji ryzyka w przebiegu MF oraz ułatwia diagnostykę różnicową chorych na MPN Ph-, co przynosi wymierne korzyści kliniczne w postaci możliwości optymalizacji leczenia nowotworów mieloproliferacyjnych.

Wkład autorów/Authors’ contributions

DL-L – opracowanie koncepcji przeprowadzonych badań, wykonanie analiz molekularnych, zebranie danych, analiza wyników, przeprowadzenie testów statystycznych, napisanie manuskryptu oraz współredagowanie manuskryptu; ŁD – zbieranie materiału do analiz molekularnych; BZ – współudział w wykonaniu analizy długości fragmentów DNA; DK – zbieranie danych klinicznych; TS – udział w opracowaniu koncepcji przeprowadzonych badań, zbieranie danych klinicznych, poprawa i współredagowanie manuskryptu oraz konsultacje i opieka merytoryczna.

Conflicts of interest

Konflikt interesu/Conflict of interest: Nie występuje.

Finansowanie/Financial support

Nie występuje.

Etyka/Ethics

Treści przedstawione w artykule są zgodne z zasadami Deklaracji Helsińskiej, dyrektywami EU oraz ujednoliconymi wymaganiami dla czasopism biomedycznych.

Piśmiennictwo/References

  • [1]

    Azzato EM, Bagg A. Molecular genetic evaluation of myeloproliferative neoplasms. Int J Lab Hematol 2015;37:61–71.

  • [2]

    Arber DA, Orazi A, Hasserjian R, et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016;127:2391–405.

  • [3]

    Vardiman JW, Thiele J, Arber DA, et al. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood 2009;114:937–51.

  • [4]

    Klampfl T, Gisslinger H, Harutyunyan AS, Nivarthi H, Rumi E, et al. Somatic mutations of CALReticulin in myeloproliferative neoplasms. N Engl J Med 2013;19:2379–90.

  • [5]

    Nangalia J, Massie CE, Baxter EJ, et al. Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2. N Engl J Med 2013;369:2391–2405.

  • [6]

    Rumi E, Pietra D, Pascutto C, et al. Clinical effect of driver mutations of JAK2, CALR, or MPL in primary myelofibrosis. Blood 2014;124:1062–9.

  • [7]

    Rumi E, Pietra D, Ferretti V, et al. JAK2 or CALR mutation status defines subtypes of essential thrombocythemia with substantially different clinical course and outcomes. Blood 2014;123:1544–51.

  • [8]

    Wang WA, Groenendyk J, Michalak M. CALReticulin signaling in health and disease. Int J Biochem Cell Biol 2012;44:842–6.

  • [9]

    Pietra D, Rumi E, Ferretti VV, et al. Differential clinical effects of different mutation subtypes in CALR-mutant myeloproliferative neoplasms. Leukemia 2016;30:431–8.

  • [10]

    Rampal R, Al-Shahrour F, Abdel-Wahab O, et al. Integrated genomic analysis illustrates the central role of JAK-STAT pathway activation in myeloproliferative neoplasm pathogenesis. Blood 2014;123:123–33.

  • [11]

    Sacha T. Ocena stopnia nasilenia objawów klinicznych i jakości życia u chorych na nowotwory mieloproliferacyjne. Biblioteka czasopisma Hematologia. Wydanie II. Via Medica 2017;24–38.

  • [12]

    Rotunno G, Mannarelli C, Guglielmelli P, et al. Impact of CALReticulin mutations on clinical and hematological phenotype and outcome in essential thrombocythemia. Blood 2014;123:1552–5.

  • [13]

    Tefferi A, Vannucchi AM. Genetic risk assessment in myeloproliferative neoplasms. Mayo Clin Proc 2017;92:1283–1290.

  • [14]

    Vainchenker W, Delhommeau F, Constantinescu SN, Bernard OA. New mutations and pathogenesis of myeloproliferative neoplasms. Blood 2011;118:1723–35.

  • [15]

    Hoffman R, Benz EJ, Silberstein LE, Heslop H, Weitz J, Anastasi J. Primary Myelofibrosis. Hematology, 7th Edition. Basic Principles and Practice. Red. Hoffman R. Elsevier Health Sciences, 2017.

  • [16]

    Tefferi A. Novel mutations and their functional and clinical relevance in myeloproliferative neoplasms: JAK2, MPL, TET2, ASXL1, CBL, IDH and IKZF1. Leukemia 2010;24:1128–38.

  • [17]

    Lundberg P, Karow A, Nienhold R, et al. Clonal evolution and clinical correlates of somatic mutations in myeloproliferative neoplasms. Blood 2014;123:2220–8.

  • [18]

    Guglielmelli P, Lasho TL, Rotunno G, et al. The number of prognostically detrimental mutations and prognosis in primary myelofibrosis: an international study of 797 patients. Leukemia 2014;28:1804–10.

  • [19]

    Brecqueville M, Rey J, Bertucci F, et al. Mutation analysis of ASXL1, CBL, DNMT3A, IDH1, IDH2, JAK2, MPL, NF1, SF3B1, SUZ12, and TET2 in myeloproliferative neoplasms. Genes Chromosomes Cancer 2012;51:743–55.

  • [20]

    Gelsi-Boyer V, Brecqueville M, Devillier R, Murati A, Mozziconacci MJ, Birnbaum D. Mutations in ASXL1 are associated with poor prognosis across the spectrum of malignant myeloid diseases. J Hematol Oncol 2012;5:12.

  • [21]

    Langabeer SE, Andrikovics H, Asp J, et al. Molecular diagnostics of myeloproliferative neoplasms. Eur J Haematol 2015;95:270–9.

  • [22]

    Guglielmelli P, Pacilli A, Rotunno G, et al. Presentation and outcome of patients with 2016 WHO diagnosis of prefibrotic and overt primary myelofibrosis. Blood 2017;129:3227–3236.

  • [23]

    Vannucchi AM, Lasho TL, Guglielmelli P, et al. Mutations and prognosis in primary myelofibrosis. Leukemia 2013;27:1861–9.

  • [24]

    Tefferi A, Guglielmelli P, Lasho TL, et al. CALR and ASXL1 mutations‑based molecular prognostication in primary myelofibrosis: an international study of 570 patients. Leukemia 2014;28:1494–500.

  • [25]

    Larsen TS, Christensen JH, Hasselbalch HC, Pallisgaard N. The JAK2 V617F mutation involves B- and T-lymphocyte lineages in a subgroup of patients with Philadelphia-chromosome negative chronic myeloproliferative disorders. Br J Haematol 2007;136:745–51.

  • [26]

    Tefferi A, Wassie EA, Guglielmelli P, et al. Type 1 versus Type 2 CALReticulin mutations in essential thrombocythemia: a collaborative study of 1027 patients. Am J Hematol 2014;89:E121–4.

  • [27]

    Tefferi A, Lasho TL, Finke C, et al. Type 1 vs type 2 CALReticulin mutations in primary myelofibrosis: differences in phenotype and prognostic impact. Leukemia 2014;28:1568–70.

  • [28]

    Andrikovics H, Krahling T, Balassa K, et al. Distinct clinical characteristics of myeloproliferative neoplasms with CALReticulin mutations. Haematologica 2014;99:1184–90.

  • [29]

    Guglielmelli P, Pietra D, Pane F, et al. Recommendations for molecular testing in classical Ph1-neg myeloproliferative disorders – A consensus project of the Italian Society of Hematology. Leuk Res 2017;58:63–72.

  • [30]

    Tefferi A, Lasho TL, Finke CM, et al. CALR vs JAK2 vs MPL-mutated or triple-negative myelofibrosis: clinical, cytogenetic and molecular comparisons. Leukemia 2014;28:1472–7.

  • [31]

    Mansier O, Migeon M, Etienne G, Bidet A, Lippert E. JAK2V617F and CALR double mutations are more frequently encountered in patients with low JAK2V617F allelic burdens. Leuk Lymphoma 2016;57:1949–51.

  • [32]

    Ahmed RZ, Rashid M, Ahmed N, Nadeem M, Shamsi TS. Coexisting JAK2V617F and CALR Exon 9 Mutations in Myeloproliferative Neoplasms – Do They Designate a New Subtype? Asian Pac J Cancer Prev 2016;17:923–6.

  • [33]

    Righetti PG, Gelfi C. Capillary electrophoresis of DNA in the 20‑500 bp range: recent developments. J Biochem Biophys Methods 1999;41:75–90.

  • [34]

    Jones AV, Ward D, Lyon M, et al. Evaluation of methods to detect CALR mutations in myeloproliferative neoplasms. Leuk Res 2015;39:82–7.

  • [35]

    Park JH, Sevin M, Ramla S, et al. CALReticulin Mutations in Myeloproliferative Neoplasms: Comparison of Three Diagnostic Methods. PLoS One 2015;10:e0141010.

  • [36]

    Haslam K, Langabeer SE, Molloy K, McMullin MF, Conneally E. Assessment of CALR mutations in myelofibrosis patients, postallogeneic stem cell transplantation. Br J Haematol 2014;166:800–2.

  • [37]

    Monzon FA, Ogino S, Hammond ME, Halling KC, Bloom KJ, Nikiforova MN. The role of KRAS mutation testing in the management of patients with metastatic colorectal cancer. Arch Pathol Lab Med 2009;133:1600–6.

  • [38]

    Jeong JH, Lee HT, Seo JY, et al. Screening PCR Versus Sanger Sequencing: Detection of CALR Mutations in Patients With Thrombocytosis. Ann Lab Med 2016 Jul;36(4):291–9.

  • [39]

    Gángó A, Mózes R, Boha Z, et al. Quantitative assessment of JAK2 V617F and CALR mutations in Philadelphia negative myeloproliferative neoplasms. Leuk Res 2018;65:42–48.

  • [40]

    Kim SY, Im K, Park SN, Kwon J, Kim JA, Lee DS. CALR, JAK2, and MPL mutation profiles in patients with four different subtypes of myeloproliferative neoplasms: primary myelofibrosis, essential thrombocythemia, polycythemia vera, and myeloproliferative neoplasm, unclassifiable. Am J Clin Pathol 2015;143:635–44.

  • [41]

    Guglielmelli P, Rotunno G, Fanelli T, et al. Validation of the differential prognostic impact of type 1/type 1-like versus type 2/type 2-like CALR mutations in myelofibrosis. Blood Cancer J 2015;5:e360.

  • [42]

    Tefferi A, Lasho TL, Tischer A, et al. The prognostic advantage of CALReticulin mutations in myelofibrosis might be confined to type 1 or type 1-like CALR variants. Blood 2014;124:2465–6.

  • [43]

    Chi J, Manoloukos M, Pierides C, et al. CALReticulin mutations in myeloproliferative neoplasms and new methodology for their detection and monitoring. Ann Hematol 2015;94:399–408.

  • [44]

    Bilbao-Sieyro C, Santana G, Moreno M, et al. High resolution melting analysis: a rapid and accurate method to detect CALR mutations. PLoS One 2014;9:e103511.

  • [45]

    Bench AJ, White HE, Foroni L, et al. Molecular diagnosis of the myeloproliferative neoplasms: UK guidelines for the detection of JAK2 V617F and other relevant mutations. Br J Haematol 2013;160:25–34.

  • [46]

    Mansier O, Migeon M, Saint-Lézer A, et al. Quantification of the Mutant CALR Allelic Burden by Digital PCR: Application to Minimal Residual Disease Evaluation after Bone Marrow Transplantation. J Mol Diagn 2016;18:68–74.

  • [47]

    Kjær L, Cordua S, Holmström MO, et al. Differential Dynamics of CALR Mutant Allele Burden in Myeloproliferative Neoplasms during Interferon Alfa Treatment. PLoS One 2016;11:e0165336.

  • [48]

    Cassinat B, Verger E, Kiladjian JJ. Interferon alfa therapy in CALR‑ -mutated essential thrombocythemia. N Engl J Med 2014;371:188–9.

  • [49]

    Verger E, Cassinat B, Chauveau A, et al. Clinical and molecular response to interferon-α therapy in essential thrombocythemia patients with CALR mutations. Blood 2015;126:2585–91.

  • [50]

    Guglielmelli P, Rotunno G, Bogani C, et al. Ruxolitinib is an effective treatment for CALR-positive patients with myelofibrosis. COMFORT-II Investigators. Br J Haematol 2016;173:938–40.

  • [51]

    Baerlocher GM, Oppliger Leibundgut E, Ottmann OG, et al. Telomerase Inhibitor Imetelstat in Patients with Essential Thrombocythemia. N Engl J Med 2015;373:920–8.

  • [52]

    Passamonti F, Caramazza D, Maffioli M. JAK inhibitor in CALR-mutant myelofibrosis. N Engl J Med 2014;370:1168–9.

  • [53]

    Patel KP, Newberry KJ, Luthra R, et al. Correlation of mutation profile and response in patients with myelofibrosis treated with ruxolitinib. Blood 2015;126:790–7.

  • [54]

    Liu Ch, Hao S. Precision Molecular Pathology of Myeloid Neoplasms. Molecular Pathology Library. Red. Chang Ch-Ch , Ohgami R. Springer International Publishing 2017:155–179.

  • [55]

    Yonal-Hindilerden I, Daglar-Aday A, Akadam-Teker B, et al. Prognostic significance of ASXL1, JAK2V617F mutations and JAK2V617F allele burden in Philadelphia-negative myeloproliferative neoplasms. J Blood Med 2015;6:157–75.

  • [56]

    Stein BL, Williams DM, O’Keefe C, et al. Disruption of the ASXL1 gene is frequent in primary, post-essential thrombocytosis and post-polycythemia vera myelofibrosis, but not essential thrombocytosis or polycythemia vera: analysis of molecular genetics and clinical phenotypes. Haematologica 2011;96:1462–9.

  • [57]

    Brecqueville M, Rey J, Devillier R, et al. Array comparative genomic hybridization and sequencing of 23 genes in 80 patients with myelofibrosis at chronic or acute phase. Haematologica 2014;99:37–45.

  • [58]

    Yannakou CK, Jones K, McBean M, et al. ASXL1 c.1934dup;p. Gly646Trpfs*12-a true somatic alteration requiring a new approach. Blood Cancer J 2017;7:656.

  • [59]

    Sorigué M, Ribera JM, García O, et al. Highly variable mutational profile of ASXL1 in myelofibrosis. Eur J Haematol 2016;97:331–5.

  • [60]

    Ricci C, Spinelli O, Salmoiraghi S, Finazzi G, Carobbio A, Rambaldi A. ASXL1 mutations in primary and secondary myelofibrosis. Br J Haematol 2012;156:404–7.

  • [61]

    Papaemmanuil E, Gerstung M, Malcovati L, et al. Clinical and biological implications of driver mutations in myelodysplastic syndromes. Blood 2013;122:3616–3627.

  • [62]

    Thol F, Friesen I, Damm F, et al. Prognostic significance of ASXL1 mutations in patients with myelodysplastic syndromes. J Clin Oncol 2011;29:2499–506.

  • [63]

    Patnaik MM, Itzykson R, Lasho TL, et al. ASXL1 and SETBP1 mutations and their prognostic contribution in chronic myelomonocytic leukemia: a two-center study of 466 patients. Leukemia 2014;28:2206–12.

  • [64]

    Alvarez Argote J, Dasanu CA. ASXL1 mutations in myeloid neoplasms: pathogenetic considerations, impact on clinical outcomes and survival. Curr Med Res Opin 2018;34:757–763.

  • [65]

    Carbuccia N, Murati A, Trouplin V, et al. Mutations of ASXL1 gene in myeloproliferative neoplasms. Leukemia 2009;23:2183–6.

  • [66]

    Bejar R, Stevenson K, Abdel-Wahab O, et al. Clinical effect of point mutations in myelodysplastic syndromes. N Engl J Med 2011;364:2496–2506.

  • [67]

    Bartels S, Schipper E, Hasemeier B, Kreipe H, Lehmann U. Routine clinical mutation profiling using next generation sequencing and a customized gene panel improves diagnostic precision in myeloid neoplasms. Oncotarget 2016;7:30084–93.

[1]

Azzato EM, Bagg A. Molecular genetic evaluation of myeloproliferative neoplasms. Int J Lab Hematol 2015;37:61–71.

[2]

Arber DA, Orazi A, Hasserjian R, et al. The 2016 revision to the World Health Organization classification of myeloid neoplasms and acute leukemia. Blood 2016;127:2391–405.

[3]

Vardiman JW, Thiele J, Arber DA, et al. The 2008 revision of the World Health Organization (WHO) classification of myeloid neoplasms and acute leukemia: rationale and important changes. Blood 2009;114:937–51.

[4]

Klampfl T, Gisslinger H, Harutyunyan AS, Nivarthi H, Rumi E, et al. Somatic mutations of CALReticulin in myeloproliferative neoplasms. N Engl J Med 2013;19:2379–90.

[5]

Nangalia J, Massie CE, Baxter EJ, et al. Somatic CALR mutations in myeloproliferative neoplasms with nonmutated JAK2. N Engl J Med 2013;369:2391–2405.

[6]

Rumi E, Pietra D, Pascutto C, et al. Clinical effect of driver mutations of JAK2, CALR, or MPL in primary myelofibrosis. Blood 2014;124:1062–9.

[7]

Rumi E, Pietra D, Ferretti V, et al. JAK2 or CALR mutation status defines subtypes of essential thrombocythemia with substantially different clinical course and outcomes. Blood 2014;123:1544–51.

[8]

Wang WA, Groenendyk J, Michalak M. CALReticulin signaling in health and disease. Int J Biochem Cell Biol 2012;44:842–6.

[9]

Pietra D, Rumi E, Ferretti VV, et al. Differential clinical effects of different mutation subtypes in CALR-mutant myeloproliferative neoplasms. Leukemia 2016;30:431–8.

[10]

Rampal R, Al-Shahrour F, Abdel-Wahab O, et al. Integrated genomic analysis illustrates the central role of JAK-STAT pathway activation in myeloproliferative neoplasm pathogenesis. Blood 2014;123:123–33.

[11]

Sacha T. Ocena stopnia nasilenia objawów klinicznych i jakości życia u chorych na nowotwory mieloproliferacyjne. Biblioteka czasopisma Hematologia. Wydanie II. Via Medica 2017;24–38.

[12]

Rotunno G, Mannarelli C, Guglielmelli P, et al. Impact of CALReticulin mutations on clinical and hematological phenotype and outcome in essential thrombocythemia. Blood 2014;123:1552–5.

[13]

Tefferi A, Vannucchi AM. Genetic risk assessment in myeloproliferative neoplasms. Mayo Clin Proc 2017;92:1283–1290.

[14]

Vainchenker W, Delhommeau F, Constantinescu SN, Bernard OA. New mutations and pathogenesis of myeloproliferative neoplasms. Blood 2011;118:1723–35.

[15]

Hoffman R, Benz EJ, Silberstein LE, Heslop H, Weitz J, Anastasi J. Primary Myelofibrosis. Hematology, 7th Edition. Basic Principles and Practice. Red. Hoffman R. Elsevier Health Sciences, 2017.

[16]

Tefferi A. Novel mutations and their functional and clinical relevance in myeloproliferative neoplasms: JAK2, MPL, TET2, ASXL1, CBL, IDH and IKZF1. Leukemia 2010;24:1128–38.

[17]

Lundberg P, Karow A, Nienhold R, et al. Clonal evolution and clinical correlates of somatic mutations in myeloproliferative neoplasms. Blood 2014;123:2220–8.

[18]

Guglielmelli P, Lasho TL, Rotunno G, et al. The number of prognostically detrimental mutations and prognosis in primary myelofibrosis: an international study of 797 patients. Leukemia 2014;28:1804–10.

[19]

Brecqueville M, Rey J, Bertucci F, et al. Mutation analysis of ASXL1, CBL, DNMT3A, IDH1, IDH2, JAK2, MPL, NF1, SF3B1, SUZ12, and TET2 in myeloproliferative neoplasms. Genes Chromosomes Cancer 2012;51:743–55.

[20]

Gelsi-Boyer V, Brecqueville M, Devillier R, Murati A, Mozziconacci MJ, Birnbaum D. Mutations in ASXL1 are associated with poor prognosis across the spectrum of malignant myeloid diseases. J Hematol Oncol 2012;5:12.

[21]

Langabeer SE, Andrikovics H, Asp J, et al. Molecular diagnostics of myeloproliferative neoplasms. Eur J Haematol 2015;95:270–9.

[22]

Guglielmelli P, Pacilli A, Rotunno G, et al. Presentation and outcome of patients with 2016 WHO diagnosis of prefibrotic and overt primary myelofibrosis. Blood 2017;129:3227–3236.

[23]

Vannucchi AM, Lasho TL, Guglielmelli P, et al. Mutations and prognosis in primary myelofibrosis. Leukemia 2013;27:1861–9.

[24]

Tefferi A, Guglielmelli P, Lasho TL, et al. CALR and ASXL1 mutations‑based molecular prognostication in primary myelofibrosis: an international study of 570 patients. Leukemia 2014;28:1494–500.

[25]

Larsen TS, Christensen JH, Hasselbalch HC, Pallisgaard N. The JAK2 V617F mutation involves B- and T-lymphocyte lineages in a subgroup of patients with Philadelphia-chromosome negative chronic myeloproliferative disorders. Br J Haematol 2007;136:745–51.

[26]

Tefferi A, Wassie EA, Guglielmelli P, et al. Type 1 versus Type 2 CALReticulin mutations in essential thrombocythemia: a collaborative study of 1027 patients. Am J Hematol 2014;89:E121–4.

[27]

Tefferi A, Lasho TL, Finke C, et al. Type 1 vs type 2 CALReticulin mutations in primary myelofibrosis: differences in phenotype and prognostic impact. Leukemia 2014;28:1568–70.

[28]

Andrikovics H, Krahling T, Balassa K, et al. Distinct clinical characteristics of myeloproliferative neoplasms with CALReticulin mutations. Haematologica 2014;99:1184–90.

[29]

Guglielmelli P, Pietra D, Pane F, et al. Recommendations for molecular testing in classical Ph1-neg myeloproliferative disorders – A consensus project of the Italian Society of Hematology. Leuk Res 2017;58:63–72.

[30]

Tefferi A, Lasho TL, Finke CM, et al. CALR vs JAK2 vs MPL-mutated or triple-negative myelofibrosis: clinical, cytogenetic and molecular comparisons. Leukemia 2014;28:1472–7.

[31]

Mansier O, Migeon M, Etienne G, Bidet A, Lippert E. JAK2V617F and CALR double mutations are more frequently encountered in patients with low JAK2V617F allelic burdens. Leuk Lymphoma 2016;57:1949–51.

[32]

Ahmed RZ, Rashid M, Ahmed N, Nadeem M, Shamsi TS. Coexisting JAK2V617F and CALR Exon 9 Mutations in Myeloproliferative Neoplasms – Do They Designate a New Subtype? Asian Pac J Cancer Prev 2016;17:923–6.

[33]

Righetti PG, Gelfi C. Capillary electrophoresis of DNA in the 20‑500 bp range: recent developments. J Biochem Biophys Methods 1999;41:75–90.

[34]

Jones AV, Ward D, Lyon M, et al. Evaluation of methods to detect CALR mutations in myeloproliferative neoplasms. Leuk Res 2015;39:82–7.

[35]

Park JH, Sevin M, Ramla S, et al. CALReticulin Mutations in Myeloproliferative Neoplasms: Comparison of Three Diagnostic Methods. PLoS One 2015;10:e0141010.

[36]

Haslam K, Langabeer SE, Molloy K, McMullin MF, Conneally E. Assessment of CALR mutations in myelofibrosis patients, postallogeneic stem cell transplantation. Br J Haematol 2014;166:800–2.

[37]

Monzon FA, Ogino S, Hammond ME, Halling KC, Bloom KJ, Nikiforova MN. The role of KRAS mutation testing in the management of patients with metastatic colorectal cancer. Arch Pathol Lab Med 2009;133:1600–6.

[38]

Jeong JH, Lee HT, Seo JY, et al. Screening PCR Versus Sanger Sequencing: Detection of CALR Mutations in Patients With Thrombocytosis. Ann Lab Med 2016 Jul;36(4):291–9.

[39]

Gángó A, Mózes R, Boha Z, et al. Quantitative assessment of JAK2 V617F and CALR mutations in Philadelphia negative myeloproliferative neoplasms. Leuk Res 2018;65:42–48.

[40]

Kim SY, Im K, Park SN, Kwon J, Kim JA, Lee DS. CALR, JAK2, and MPL mutation profiles in patients with four different subtypes of myeloproliferative neoplasms: primary myelofibrosis, essential thrombocythemia, polycythemia vera, and myeloproliferative neoplasm, unclassifiable. Am J Clin Pathol 2015;143:635–44.

[41]

Guglielmelli P, Rotunno G, Fanelli T, et al. Validation of the differential prognostic impact of type 1/type 1-like versus type 2/type 2-like CALR mutations in myelofibrosis. Blood Cancer J 2015;5:e360.

[42]

Tefferi A, Lasho TL, Tischer A, et al. The prognostic advantage of CALReticulin mutations in myelofibrosis might be confined to type 1 or type 1-like CALR variants. Blood 2014;124:2465–6.

[43]

Chi J, Manoloukos M, Pierides C, et al. CALReticulin mutations in myeloproliferative neoplasms and new methodology for their detection and monitoring. Ann Hematol 2015;94:399–408.

[44]

Bilbao-Sieyro C, Santana G, Moreno M, et al. High resolution melting analysis: a rapid and accurate method to detect CALR mutations. PLoS One 2014;9:e103511.

[45]

Bench AJ, White HE, Foroni L, et al. Molecular diagnosis of the myeloproliferative neoplasms: UK guidelines for the detection of JAK2 V617F and other relevant mutations. Br J Haematol 2013;160:25–34.

[46]

Mansier O, Migeon M, Saint-Lézer A, et al. Quantification of the Mutant CALR Allelic Burden by Digital PCR: Application to Minimal Residual Disease Evaluation after Bone Marrow Transplantation. J Mol Diagn 2016;18:68–74.

[47]

Kjær L, Cordua S, Holmström MO, et al. Differential Dynamics of CALR Mutant Allele Burden in Myeloproliferative Neoplasms during Interferon Alfa Treatment. PLoS One 2016;11:e0165336.

[48]

Cassinat B, Verger E, Kiladjian JJ. Interferon alfa therapy in CALR‑ -mutated essential thrombocythemia. N Engl J Med 2014;371:188–9.

[49]

Verger E, Cassinat B, Chauveau A, et al. Clinical and molecular response to interferon-α therapy in essential thrombocythemia patients with CALR mutations. Blood 2015;126:2585–91.

[50]

Guglielmelli P, Rotunno G, Bogani C, et al. Ruxolitinib is an effective treatment for CALR-positive patients with myelofibrosis. COMFORT-II Investigators. Br J Haematol 2016;173:938–40.

[51]

Baerlocher GM, Oppliger Leibundgut E, Ottmann OG, et al. Telomerase Inhibitor Imetelstat in Patients with Essential Thrombocythemia. N Engl J Med 2015;373:920–8.

[52]

Passamonti F, Caramazza D, Maffioli M. JAK inhibitor in CALR-mutant myelofibrosis. N Engl J Med 2014;370:1168–9.

[53]

Patel KP, Newberry KJ, Luthra R, et al. Correlation of mutation profile and response in patients with myelofibrosis treated with ruxolitinib. Blood 2015;126:790–7.

[54]

Liu Ch, Hao S. Precision Molecular Pathology of Myeloid Neoplasms. Molecular Pathology Library. Red. Chang Ch-Ch , Ohgami R. Springer International Publishing 2017:155–179.

[55]

Yonal-Hindilerden I, Daglar-Aday A, Akadam-Teker B, et al. Prognostic significance of ASXL1, JAK2V617F mutations and JAK2V617F allele burden in Philadelphia-negative myeloproliferative neoplasms. J Blood Med 2015;6:157–75.

[56]

Stein BL, Williams DM, O’Keefe C, et al. Disruption of the ASXL1 gene is frequent in primary, post-essential thrombocytosis and post-polycythemia vera myelofibrosis, but not essential thrombocytosis or polycythemia vera: analysis of molecular genetics and clinical phenotypes. Haematologica 2011;96:1462–9.

[57]

Brecqueville M, Rey J, Devillier R, et al. Array comparative genomic hybridization and sequencing of 23 genes in 80 patients with myelofibrosis at chronic or acute phase. Haematologica 2014;99:37–45.

[58]

Yannakou CK, Jones K, McBean M, et al. ASXL1 c.1934dup;p. Gly646Trpfs*12-a true somatic alteration requiring a new approach. Blood Cancer J 2017;7:656.

[59]

Sorigué M, Ribera JM, García O, et al. Highly variable mutational profile of ASXL1 in myelofibrosis. Eur J Haematol 2016;97:331–5.

[60]

Ricci C, Spinelli O, Salmoiraghi S, Finazzi G, Carobbio A, Rambaldi A. ASXL1 mutations in primary and secondary myelofibrosis. Br J Haematol 2012;156:404–7.

[61]

Papaemmanuil E, Gerstung M, Malcovati L, et al. Clinical and biological implications of driver mutations in myelodysplastic syndromes. Blood 2013;122:3616–3627.

[62]

Thol F, Friesen I, Damm F, et al. Prognostic significance of ASXL1 mutations in patients with myelodysplastic syndromes. J Clin Oncol 2011;29:2499–506.

[63]

Patnaik MM, Itzykson R, Lasho TL, et al. ASXL1 and SETBP1 mutations and their prognostic contribution in chronic myelomonocytic leukemia: a two-center study of 466 patients. Leukemia 2014;28:2206–12.

[64]

Alvarez Argote J, Dasanu CA. ASXL1 mutations in myeloid neoplasms: pathogenetic considerations, impact on clinical outcomes and survival. Curr Med Res Opin 2018;34:757–763.

[65]

Carbuccia N, Murati A, Trouplin V, et al. Mutations of ASXL1 gene in myeloproliferative neoplasms. Leukemia 2009;23:2183–6.

[66]

Bejar R, Stevenson K, Abdel-Wahab O, et al. Clinical effect of point mutations in myelodysplastic syndromes. N Engl J Med 2011;364:2496–2506.

[67]

Bartels S, Schipper E, Hasemeier B, Kreipe H, Lehmann U. Routine clinical mutation profiling using next generation sequencing and a customized gene panel improves diagnostic precision in myeloid neoplasms. Oncotarget 2016;7:30084–93.

Journal Information

Figures

  • View in gallery

    Analiza obecności mutacji w genie CALR z zastosowaniem analizy długości fragmentów DNA (A-1, B-1) oraz sekwencjonowania Sangera (A-2, B-2). Delecja 52 par zasad (210 pz) obliczona w odniesieniu do dzikiego wariantu genu o wielkości 263 pz (A-1). Insercja 5 par zasad (268 pz) wskazana w odniesieniu do dzikiego wariantu genu (263 pz) (B-1)

    Fig. 1. The presence of mutations in the CALR gene analyzed by PCR fragment analysis (A-1, B-1) and Sanger sequencing (A-2, B-2). The 52 base pair (210 pz) deletion calculated with reference to the wild variant gene (263 pz) (A-1). The 5 base pare insertion detected with reference to the wild variant gene (263 pz) (B-1)

  • View in gallery

    Rozkład mutacji w wybranych genach JAK2, CALR, MPL na przykładzie badanej grupy pacjentów chorych na ET oraz MF

    Fig. 2. The distribution of mutation analysed in JAK2, CALR and MPL genes in the study grup of patients with ET or MF

  • View in gallery

    Ocena czułości wykrywania mutacji w eksonie 9 genu CALR w oparciu o seryjne rozcieńczenie DNA z wariantem c.1099_1150del52 w DNA zdrowego dawcy; analiza długości fragmentów DNA (A), sekwencjonowanie Sangera (B)

    Fig. 3. Evaluation of method sensitivity for the detection of mutations within exon 9 of the CALR gene. Serial dilutions of DNA with the c.1099_1150del52 mutation in the DNA of a healthy donor were used for the study; fragment analysis (A), Sanger sequencing (B)

  • View in gallery

    Ocena czułości diagnostycznej sekwencjonowania Sangera w oparciu o seryjne rozcieńczenia DNA z potwierdzoną zmianą w genie ASXL1: c.1934dupG (p.Gly646Trpfs12) (A), c.3759T>C (p.Ser1253=) (B)

    Fig. 4. Estimation of diagnostic sensitivity of Sanger sequencing with the use of DNA with confirmed ASXL1 variant gene: c. 1934dupG (p.Gly646Trpfs12) (A), c.3759T>C (p.Ser1253=) (B)

Metrics

All Time Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 134 134 40
PDF Downloads 92 92 36